Table Of ContentJBC Papers in Press. Published on April 12, 2007 as Manuscript M610510200
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M610510200
ROLE OF THE TRANSCRIPTION FACTOR ATF4
IN THE ANABOLIC ACTIONS OF INSULIN
AND THE ANTI-ANABOLIC ACTIONS OF GLUCOCORTICOIDS*
Christopher M. Adams
From the Department of Internal Medicine, UT Southwestern Medical Center, Dallas, Texas 75390
and the Department of Internal Medicine, The University of Iowa, Iowa City, Iowa 52242
Running title: Regulation of ATF4 by Glucocorticoids and Insulin
Address correspondence to: Christopher M. Adams, Department of Internal Medicine, The University of
Iowa, Iowa City, Iowa 52242, Tel. 319-353-7812; Fax. 319-353-7850;
E-Mail: [email protected]
In most mammalian cells, insulin and during times of prolonged fasting or stress, when
glucocorticoids promote anabolism and protein and lipid are mobilized from peripheral
catabolism, respectively. While the opposing tissues and utilized for gluconeogenesis, fatty acid
effects of insulin and glucocorticoids on oxidation and ketogenesis. Human health requires
D
o
catabolic gene expression have been explained that the opposing metabolic effects of insulin and w
n
at the molecular level, comparatively little is glucocorticoids remain in net balance, yet a lo
a
d
known about how these hormones alter number of pathological conditions tip the balance ed
anabolic gene expression. These studies towards catabolism, resulting in atrophy of fro
m
identify ATF4 as an anabolic transcription peripheral tissues. These conditions include h
ttp
factor that is repressed by glucocorticoids and starvation, glucocorticoid excess (Cushing’s ://w
induced by insulin. Insulin-mediated induction syndrome), absolute or relative insulin deficiency w
w
of ATF4 required the mammalian target of (as in uncontrolled type 1 or type 2 diabetes .jb
c
rapamycin complex 1 (mTORC1); was mellitus), critical illnesses (such as burns, trauma .o
rg
required for the activation of a genetic program or sepsis), or chronic illnesses (such as uremia, b/
y
for the cellular uptake of essential amino acids cancer, AIDS or tuberculosis). Indeed, atrophy of g
u
e
and the synthesis of nonessential amino acids skin, muscle and bone are predictable side effects st o
and aminoacyl-tRNAs; and was coupled to the when supra-physiologic doses of glucocorticoids n A
p
rperporteeisnsi oann dof lFipoixdo -dcaeptaebnodleisnmt .g e nTesh enseee dreeds uflotrs areresp ounsseed. clinically to suppress the immune ril 4, 2
0
suggest that ATF4 plays a central role in Insulin and glucocorticoids induce many 1
9
hormonal regulation of amino acid and protein of their metabolic effects by altering the
anabolism, by coupling amino acid uptake and expression of key genes needed for anabolic and
synthesis, as well as the generation of charged catabolic processes. Transcriptional control of
tRNAs, to mTORC1-mediated mRNA catabolic gene expression by these hormones has
translation. been extensively studied, leading to a generalized
molecular model that explains how catabolic genes
are induced by glucocorticoids and repressed by
Insulin levels rise after feeding, promoting
insulin. Under fasting conditions, the presence of
anabolic processes (such as the uptake of amino
glucocorticoids coupled with lower levels of
acids, glucose and lipid, and the synthesis of
insulin permits the glucocorticoid receptor (GR)
protein, glycogen and lipid), while inhibiting
and Foxo transcription factors to bind cis-acting
catabolic processes (such as protein breakdown,
DNA regulatory elements present in genes
gluconeogenesis, glycogenolysis, lipolysis, fatty
encoding key proteins needed for protein
acid oxidation, and ketogenesis) (1). In contrast to
catabolism (Atrogin-1 and MuRF1), lipid
insulin, glucocorticoids inhibit anabolism while
catabolism (pyruvate dehydrogenase kinase-4
promoting catabolism (2). These effects of
(PDK4)), and gluconeogenesis (PEPCK). All of
glucocorticoids are required for human survival
these catabolic genes require the combined
1
Copyright 2007 by The American Society for Biochemistry and Molecular Biology, Inc.
presence of the GR and Foxo proteins in order to EXPERIMENTAL PROCEDURES
become transcriptionally active (3-8). Conversely,
after feeding, high levels of insulin initiate a signal Materials and Buffers - Dexamethasone, insulin
transduction cascade that includes activation of the (from bovine pancreas), rapamycin and mouse
protein kinase Akt (9). Akt phosphorylates the recombinant insulin-like growth factor-1 (IGF-1)
Foxo proteins, causing them to release from their were obtained from Sigma. [3H]-leucine was
DNA binding sites and translocate out of the obtained from ARC. The following buffers were
nucleus (10), thus de-activating the catabolic used: Buffer A contains 50 mM Hepes-KOH, pH
genes. Importantly, under physiologic conditions, 7.4, 250 mM sucrose, 10 mM KCl, 1.5 mM
insulin has a dominant effect, overriding MgCl , 5 mM sodium EDTA, 5 mM sodium
2
glucocorticoids in order to turn off catabolism EGTA, and protease inhibitor mixture (25 µg/ml
(11). Conversely, when insulin levels are low, the N-acetyl-leucinal-leucinal-norleucinal (ALLN), 1
continued presence of glucocorticoids provides the µg/ml pepstatin A, 2 µg/ml aprotonin, 10 µg/ml
default setting of metabolism (towards leupeptin, 200 µM phenylmethylsulfonyl
catabolism), maintaining homeostasis in the fluoride). Buffer B contains 10 mM Tris-HCl, pH
absence of feeding, which may occur with 7.6, 100 mM NaCl, 1% (w/v) SDS, and protease
unpredictable frequency. inhibitor mixture. Buffer C contains 20 mM
In contrast to our current understanding of Hepes-KOH, pH 7.6, 25% (v/v) glycerol, 420 mM D
o
how catabolic genes are regulated by NaCl, 1.5 mM MgCl , 1 mM sodium EDTA, 1 w
2 n
glucocorticoids and insulin, relatively little is mM sodium EGTA, and protease inhibitor loa
d
known of how these hormones regulate anabolic mixture. Buffer D contains 250 mM Tris-HCl, pH ed
gene expression. This is particularly true of 6.8, 10% SDS, 25% glycerol, 0.2% (w/v) from
anabolic genes that might augment insulin- bromophenol blue, and 5% (w/v) 2- http
mediated protein synthesis, or might be repressed mercaptoethanol. ://w
during glucocorticoid-mediated protein Cell Culture - Tissue culture medium A is w
w
catabolism. The anabolic genes encoding amino Dulbecco’s modified Eagle’s medium (DMEM) .jb
c
acid biosynthetic enzymes, amino acid transporters containing 1 g/L glucose (Mediatech #10-014) .org
and aminoacyl-tRNA synthetases are known to be plus 100 units/ml penicillin, 100 µg/ml by/
activated by ATF4 (also known as CREB2), a g
streptomycin sulfate and 10% (v/v) fetal bovine u
e
basic-leucine zipper (bZIP) transcription factor serum (FBS); medium B is DMEM containing 4.5 st o
that is increased when cultured cells are deprived g/L glucose (Mediatech #10-013) plus 100 n A
p
oTfh ea meifnfoe catcs idosf org lsuucbojceoctretidc otiod sE Ra nsdtr esins s(u1li2n- 15o)n. uanndit s1/m0%l p eFnBicSi;l limn,e 1d0iu0m µ gC/m ils stDreMptEoMm yccoinn tsauilnfiantge ril 4, 2
0
ATF4 and these genes are currently not known, 1
4.5 g/L glucose (ATCC #30-2002) plus 100 9
although mice lacking ATF4 are >50% smaller
units/ml penicillin, 100 µg/ml streptomycin sulfate
than normal in size and have a variety of
and 10% FBS. Mouse L cells (D9 strain (19)) were
developmental defects, which is consistent with a
kindly provided by Dr. Stuart Kornfeld
deficiency in protein anabolism (16-18).
(Washington University, St. Louis, MO) and were
The studies presented here had two
maintained in monolayer in medium A at 37 °C
principal goals: First, to examine whether
and an atmosphere of 8-9% CO . MEF-1 cells
glucocorticoid- and insulin-mediated effects on 2
(20) were maintained in monolayer in medium B
catabolic gene expression might be accompanied
at 37 °C and an atmosphere of 8-9% CO . With
by reciprocal effects on anabolic gene expression; 2
the exception of experiments using RNA
and second, to begin to understand the molecular
interference (as described below), mouse L cells
pathways used by glucocorticoids and insulin to
and MEF cells were set up for experiments in
regulate genes involved in amino acid and protein
medium A or medium B, respectively, at a density
anabolism.
of 7 X 105 cells/100-mm dish. Two days later,
cells were washed twice with phosphate buffered
saline (PBS), then subjected to the incubation
protocols described in the Figure Legends. C2C12
2
mouse myoblasts (ATCC) were maintained in protocol. In experiments using C2C12 myotubes,
medium C, set up for experiments at a density of 7 total cellular RNA was first extracted using
X 105 cells/100-mm dish, and induced to TRIZOL reagent (Invitrogen) according to the
differentiate into myotubes by replacing 10% FBS manufacturer’s instructions prior to purification on
with 2% horse serum, as described (3). After 4 RNA easy columns. cDNA synthesis, qPCR and
days in differentiation medium, myotubes were data analysis were performed as previously
washed twice with PBS, then subjected to the described (22). All qPCR reactions were
incubation protocols described in the Figure performed in triplicate and the cycle threshold
Legends. values were averaged to give the final results.
RNA Interference - Mouse L cells were set up at a mRNA encoding 36B4 was used as the invariant
density of 1.5 X 105 cells/60-mm dish on day 0. control in all studies. qPCR primer sequences
On day 1, cells were washed with PBS, re-fed with may be found in the Supplemental Data.
medium A lacking penicillin and streptomycin (3 Analysis of Cell Number and Viability - Following
ml/dish), followed by the addition of a mixture incubation, mouse L cells were washed with PBS,
containing 1 ml OptiMEM (Gibco), 10 µL lifted from 100-mm dishes using 2 ml trypsin /
Lipofectamine 2000 reagent (Invitrogen) and 200 EDTA solution (Mediatech #25-052), followed by
nM siRNA duplex (to give a final siRNA the immediate addition of 18 ml of medium A
concentration of 50 nM). Control cells were containing 1% FBS. An aliquot of resuspended D
o
transfected with siCONTROL nontargeting siRNA cells was then stained with trypan blue and w
n
(Dharmacon). The siRNA duplex targeting ATF4 counted using a hemocytometer. lo
a
contained the following nucleotide sequence (5’ to Metabolic Labeling - [3H]-leucine (120 Ci/mmol; ded
3’): sense GAGCAUUCCUUUAGUUUAGUU; 20 µCi /dish) was added directly to the cell culture fro
m
antisense CUAAACUAAAGGAAUGCUCUU. medium, after which one dish from each h
ttp
On day 2 (24 h after transfection), cells were re- experimental condition was placed at 4° C (in ://w
fed with serum-free medium A, then subjected to order to measure background incorporation of w
w
varying conditions of incubation as described in [3H]-leucine), whereas three dishes from each .jb
c
Figure Legends. Following incubation, the cells condition were placed back in the 37° C incubator. .org
from two identically treated dishes were pooled Following incubation, cells were washed twice b/
y
and harvested for total cellular protein extracts; the with PBS then harvested, and an aliquot of cells gu
e
cells from three identically treated dishes were was subjected to precipitation using 10% (w/v) st o
n
pooled and harvested for total cellular RNA, trichloroacetic acid (TCA) in the presence of 0.45 A
p
followed by qPCR analysis; or the cells from two % salmon sperm DNA. TCA precipitates were ril 4
identically treated dishes were harvested for then applied to glass fiber filters set upon a , 2
0
analysis of intracellular free amino acids. vacuum manifold. Filters were sequentially 19
Analysis of Cellular mRNAs Using washed with 10% TCA, 5% TCA, and 95%
Oligonucleotide Microarrays - Following ethanol, then placed in scintillation cocktail for
incubation, the cells from three identically treated measurement of acid-insoluble radioactivity. The
100-mm dishes were pooled and total cellular final results were obtained by averaging the counts
RNA was harvested using STAT-60 reagent (Tel- obtained from the three dishes in each condition
Test), according to the manufacturer’s protocol. that were incubated at 37° C, then subtracting the
The RNA was then subjected to microarray background count obtained from the dish
analysis using established protocols (21), incubated at 4° C, then normalizing the counts to
GeneChip mouse genome 430 2.0 microarrays,
the total mg of protein / dish under each condition.
and a GeneChip 3000 scanner (Affymetrix). Data
Preparation of Nuclear Extracts - Because ATF4
was analyzed using GeneChip operating software
has an extremely short half-life (30-60 min)
(v1.1.1, from Affymetrix), and the final results
secondary to proteosomal degradation (23), the
represent the average fold-change in mRNA levels
cells were treated with the proteosome inhibitor
obtained from 3 independent experiments.
ALLN (25 µg/ml), for the final 1 h of incubation,
Analysis of Cellular mRNAs by qPCR - Total
as is routinely done in studies of proteins with
cellular mRNA was isolated using the RNAeasy
rapid turn-over, such as SREBPs (24). Following
kit (Qiagen), according to the manufacturers
3
incubation, the cells from three identically treated Glucocorticoids Induce Mouse L Cell Fibroblasts
100-mm dishes of cells were washed once with to Enter a Metabolically Quiescent, Long-Lived
cold PBS, scraped and pooled into 50 ml tubes on State that Is Reversed by Insulin - Mouse L cell
ice, then centrifuged at 1000 x g for 5 min. Cell fibroblasts were used to study the metabolic
pellets were resuspended in 1.2 ml buffer A then effects of glucocorticoids and insulin. These
passed through a 22-gauge needle 22 times, immortalized cells contain high levels of
followed by centrifugation at 1000 x g for 5 min. endogenous GR and resemble non-transformed
The 1000 x g pellet was resuspended in 250 µl peripheral mammalian cells in their capacity to
buffer C, rotated at 4 °C for 1 h, then centrifuged slow their rate of anabolism in response to
at 20,000 x g for 20 min to remove insoluble glucocorticoids (25). As shown in Fig. 1A,
material. The protein concentration was then dexamethasone dramatically prolonged cell
measured using the BCA kit (Pierce), after which survival when mouse L cells were cultured in the
a 25 µg aliquot was mixed with 0.25 volume of absence of serum (which was omitted in order to
buffer D and heated for 5 minutes at 95 °C. prevent interference with any subsequent studies
using insulin). In this experiment, cells were
Preparation of Total Cell Extracts - 25 µg/ml
incubated in the absence or presence of
ALLN was added directly to the medium for the
dexamethasone, and re-fed with fresh culture
last 1 h of incubation. Following incubation, the
medium every 2 weeks. After various times of
cells were washed once with cold PBS, then D
o
incubation, dishes of cells from each group were w
treated with buffer B (150 µl/60-mm dish, or 500 n
harvested for analysis of cell number and viability. lo
µl/100-mm dish), and scraped into 1.5 ml tubes on ad
In the absence of dexamethasone, cells initially ed
ice. The cells were then passed through a 22- proliferated, but then died within 10 days of fro
gauge needle 11 times, and then shaken for 20 m
incubation. In contrast, if dexamethasone was h
minutes at room temperature using a Vortex Genie ttp
2 (Fisher). The protein concentration of each total present, the number of cells per dish did not ://w
increase, and many cells remained viable for > 85 w
cell extract was measured using the BCA kit, after w
which an aliquot of cell extract (50 µg) was mixed days of incubation. These effects of .jbc
dexamethasone were reversible, as removal of .o
with 0.25 volume of buffer D and heated for 5 rg
dexamethasone from the cell culture medium after b/
minutes at 95 °C. 15 days of incubation allowed the cells to initially y g
u
SDS-PAGE and Immunoblot Analysis - Samples e
were subjected to 10% SDS-PAGE, then pprroolmifoetriaotne, obfu ct eulll tismuravtievlyal luedn dteor ctheells ed ecaotnhd. i tiTohnes st on A
transferred to Hybond-C extra nitrocellulose filters p
(rMooimlli ptoerme)p.e r atIumrem uusnionbgl oats 1:w1e0r0e0 pdeirlufotiromne do f aat wcoarst icao sstpeerocnifeic, effetchte of GmRa jaogro nistse n(dinocgleundoinugs ril 4, 20
glucocorticoid hormone in mice); required only 1
9
rabbit polyclonal antiserum SC-200 (Santa Cruz),
low, physiologic concentrations of glucocorticoids
which recognizes the COOH-terminus of mouse
(the EC for dexamethasone was < 3 nM); and
50
ATF4.
was not reproduced by other steroid hormones
Measurement of Intracellular Free Amino Acids -
such as progesterone, estradiol or testosterone
Following incubation, cells were washed three
(data not shown). Interestingly, the addition of
times with cold PBS and scraped into 10% (v/v)
insulin (in the continued presence of
methanol (150 µl/60-mm dish). Lysates from two
dexamethasone) had the same effect as the
identically-treated dishes of cells were pooled,
removal of dexamethasone, inducing cell death
protein concentrations were determined using the
(Fig. 1A), although insulin did not elicit the same
BCA method and free (non-hydrolyzed) amino
degree of cellular proliferation as was observed
acid concentrations were determined using cation
when dexamethasone was removed.
exchange chromatography (Hitachi L-8800 amino
To test the idea that dexamethasone and
acid analyzer).
insulin might have opposing effects on metabolism
under serum-free conditions, mouse L cells were
RESULTS
incubated in the absence or presence of
dexamethasone for 48 h, followed by an additional
6 h incubation in the absence or presence of
4
insulin, which was directly added to the cell amino acid transporters, amino acid biosynthetic
culture medium in the continued presence of enzymes or aminoacyl-tRNA synthetases were
dexamethasone. Dexamethasone decreased global particularly interesting, as this group of mRNAs
protein synthesis (as assessed by the incorporation was not previously known to be regulated by
of [3H]-leucine into TCA-insoluble cellular insulin or glucocorticoids.
protein), and under these conditions, insulin
induced a 4 -fold increase in protein synthesis Glucocorticoids Repress Expression of ATF4 and
(Fig. 1Β). These data indicate that GR activation mRNAs involved in Amino Acid and Protein
causes serum-starved mouse L cells to enter a Anabolism- Of the 13 class I transcripts involved
metabolically quiescent, long-lived state. Under in amino acid and protein anabolism, 7 are known
these conditions, insulin overrides the effects of to be induced through the actions of ATF4 when
glucocorticoids on both cell survival and protein cells are deprived of amino acids (12). Moreover,
synthesis. all of the genes encoding these 13 class I
To test the hypothesis that glucocorticoids transcripts contained potential ATF4 binding sites
and insulin might have opposing effects on (shown in Supplementary Table 2). This
metabolic gene expression, global gene expression suggested the hypothesis that ATF4 might be
was examined using oligonucleotide microarrays. required for expression of these mRNAs, and thus,
Serum-starved L cells were incubated for 54 h in that glucocorticoids might exert an inhibitory D
o
the absence or presence of dexamethasone, or 54 h effect on ATF4. To test this hypothesis, mRNA w
n
in the presence of dexamethasone with insulin also levels were measured using quantitative real time lo
a
d
present for the final 6 h of incubation. To identify RT-PCR and ATF4 protein levels were analyzed ed
mRNA transcripts that may have important roles by immunoblot. Fig. 2A shows that fro
m
in metabolism, the analysis focused on transcripts dexamethasone repressed levels of two h
ttp
that were subject to opposing regulation by representative class I transcripts (encoding ://w
dexamethasone and insulin. Fig. 1C describes asparagine synthetase (Asns) and phosphoserine w
w
mRNA transcripts that were either: repressed ≥ aminotransferase 1 (Psat1)), and also repressed .jb
c
50% by dexamethasone and then induced ≥ 2-fold levels of ATF4 mRNA and protein. The effect of .o
rg
by insulin (class I transcripts, which consisted of dexamethasone occurred at low concentrations b/
y
54 mRNAs); or induced ≥ 2-fold by approximating a physiologic concentration of g
u
e
dexamethasone and then repressed ≥ 50% by glucocorticoid hormone, and was mimicked by st o
insulin (class II transcripts, which consisted of 82 corticosterone. Moreover, the effect of n A
p
mdeRpNosAitse)d. iTn hGe EcOom apnlde tteh em iccormoaprlreatye dliastta ohfa cs labsese nI dReUx a4m8e6t,h aansdo nwe aws anso bt lroecpkroedd ubcye dth bey G pRro agnetsatgeroonniest. ril 4, 2
0
and II transcripts is provided in Supplementary Figure 2B shows that the inhibitory effect of 1
9
Table 1. dexamethasone on ATF4 and mRNAs encoding
Many of the class I transcripts encoded Asns and Psat1 only occurred when mouse L cells
proteins with clear roles in anabolism, including 4 were incubated in the absence of serum. This
amino acid transporters, 5 amino acid biosynthetic finding is consistent with the notion that serum
enzymes, 4 aminoacyl-tRNA synthetases; as well contains growth factors (such as insulin) that
as 12 proteins required for lipid synthesis or likely override the effect of dexamethasone.
uptake. In contrast, several of the class II Indeed, dexamethasone-mediated induction of
transcripts encoded proteins with established roles PDK4 mRNA levels was also blocked by the
in catabolism and the cellular response to presence of serum (Fig. 2B). The effect of
starvation, including Atrogin-1, MuRF1 and dexamethasone on ATF4 mRNA and ATF4-
PDK4, as well as the mRNA encoding glutamine dependent mRNAs was slow, requiring 48 h for
synthetase (Glul). Thus, dexamethasone induced maximal effect, and was temporally dissociated
catabolic gene expression, while suppressing from the induction of PDK4 mRNA, which was
anabolic gene expression; and insulin overcame maximal within 12-24 h of dexamethasone
the catabolic effects of dexamethasone, shifting treatment (Fig 2C). Taken together, these data
the balance back towards anabolic gene indicate that GR activation suppresses ATF4 and
expression. The 13 class I transcripts encoding ATF4-dependent mRNAs, and induces catabolic
5
mRNAs, provided that anabolic stimuli (such as the uptake of the 12 essential amino acids (28)
insulin or serum) are not present. (Fig. 3B). This suggested the hypothesis that
ATF4 expression might be required to maintain
ATF4 Is Required for the Expression of mRNAs intracellular levels of Asn, Ser, Gly, Pro and the
Involved in Amino Acid and Protein Anabolism - 12 essential amino acids. To test this idea, ATF4
To determine if ATF4 might be required for the expression was reduced using RNAi, and
expression of mRNAs involved in amino acid and intracellular free amino acids were measured using
protein anabolism, RNA interference (RNAi) was ion exchange chromatography. This technique
used to knockdown ATF4 expression. In cells that measures levels of 19 amino acids (excluding
were incubated in serum-free medium lacking Trp), although Asn is not distinguished from Asp,
dexamethasone, a small interfering RNA (siRNA) and Gln is not distinguished from Glu.
targeting the coding region of ATF4 mRNA Fig. 3C shows that the siRNA targeting
mimicked the effect of dexamethasone, reducing ATF4 reduced levels of Gly, Ser and Pro, as well
levels of ATF4 mRNA and protein as well as 13 as levels of 10 essential amino acids. The levels
mRNA transcripts encoding amino acid of Cys were too low to be accurately measured.
biosynthetic enzymes, amino acid transporters or Levels of Ala, and the combined levels of Asn and
aminoacyl-tRNA synthetases (Fig 3A). In Asp, and of Gln and Glu were not significantly
contrast, the siRNA targeting ATF4 did not altered. The net effect of ATF4 repression was to
D
o
significantly alter levels of control transcripts reduce levels of total and essential amino acids by w
n
(desmin and mTOR), mRNAs encoding PDK4 and 21% and 30%, respectively (Fig. 3C, right panel). lo
a
d
Glul (class II transcripts), mRNA encoding Taken together, these data indicate that ed
glutamine dehydrogenase (Glud1) (another amino glucocorticoids repress ATF4 expression, which is fro
m
acid biosynthetic enzyme), or mRNAs encoding required for the expression of anabolic mRNAs h
ttp
the LDL receptor (LDLR) and HMG-CoA needed to maintain intracellular levels of most ://w
reductase (HMGCR) (two representative class I amino acids. w
w
transcripts involved in lipid anabolism). Similar .jb
c
results were obtained using an siRNA targeting the Insulin Overrides the Repressive Effect of .o
rg
5’ untranslated region of the ATF4 mRNA Glucocorticoids on ATF4 and Downstream b/
y
transcript (not shown). RNAi was also used to test mRNAs – The microarray studies indicated that 13 g
u
e
the role of a closely related bZIP transcription mRNAs involved in amino acid and protein st o
factor, ATF5, which was encoded by a class I anabolism were not only repressed by n A
p
trreapnosrctreirp t coanndst ruhcats cboenetna insihnogw nth et o Aascntsiv atgee nea dinesxualmine twhaass oanded, edb utot dwexeraem eathlsaos onined-turecaetde d wchelelns ril 4, 2
0
promoter (26). The siRNA targeting ATF5 (Fig. 1C). This suggested the hypothesis that 1
9
produced > 80% knockdown of ATF5 mRNA, but insulin might override the repressive effect of
there was no effect on either ATF4 or ATF4- dexamethasone on ATF4, thereby increasing
dependent mRNAs (not shown). These data levels of these mRNAs. In support of this
indicate that ATF4 is required for expression of hypothesis, insulin increased levels of both ATF4
mRNAs involved in amino acid and protein mRNA and protein in dexamethasone-treated cells
anabolism, and that glucocorticoids repress these (Fig. 4A). In the absence of dexamethasone,
mRNAs at least in part by decreasing ATF4 insulin had little effect on ATF4 mRNA or
expression. protein, presumably because levels were already
In mouse L cells, 8 amino acids are high (Fig. 4A). Figure 4B shows a time course
nonessential: Glu, Gln, Asp, Asn, Ala, Ser, Gly study examining insulin’s effect in
and Pro (27). The ATF4-dependent transcripts dexamethasone-treated L cells. At early time
encode seven enzymes (Asns, Psat1, Phgdh, Psph, points (2-4 h), insulin decreased PDK4 mRNA but
Shmt2, Mthfd2, and Pycr1) necessary for the increased ATF4 mRNA and global protein
synthesis of 4 of these nonessential amino acids synthesis. This was followed by an increase in
(Asn, Ser, Gly and Pro) (Fig. 3B). The ATF4- ATF4-dependent mRNAs (encoding Asns and
dependent transcripts also encode three amino acid Psat1), which began to rise after 4-6 h of insulin
transporters (Slc1a4, Slc7a1, Slc7a5) sufficient for treatment. Whereas protein synthesis and ATF4
6
mRNA levels remained relatively stable over the mRNA transcripts that were found to be ATF4-
next 18 h of insulin treatment, levels of ATF4- dependent in mouse L cells. The serum-dependent
dependent mRNAs continued to accumulate. The increases in ATF4 and downstream transcripts
effects of insulin on ATF4 and ATF4-dependent were blocked by rapamycin, indicating a
mRNAs occurred at low, physiologic dependence on mTORC1 activity.
concentrations of insulin (Fig. 4C). IGF-1 had an In contrast to mouse L cells and MEF
identical effect on ATF4 mRNA and protein levels cells, C2C12 myotubes represent a differentiated,
(not shown). The EC for both insulin and IGF-1 nonproliferating cell type that is used as a model
50
was < 3 nM, suggesting that their effects were of skeletal muscle. In C2C12 myotubes,
mediated through the insulin and IGF-1 receptors, insulin/IGF-1 signaling induces protein synthesis
respectively. RNAi was used to determine and myotube hypertrophy, and these effects are
whether insulin-mediated induction of these blocked by rapamycin (3-4,33). Fig. 6B shows
mRNAs required ATF4 (Fig. 4D). The siRNA that insulin increased levels of nuclear ATF4
targeting ATF4 did not alter levels of control protein in myotubes, and the effect was blocked by
transcripts, or prevent insulin-mediated repression rapamycin. Fig. 6C shows the effect of
of PDK4 mRNA, but it blocked the insulin- insulin/IGF-1 signaling on mRNA levels. IGF-1
mediated increase in mRNAs involved in amino increased levels of mRNAs encoding ATF4 and
acid and protein anabolism. Thus, these data all of the mRNAs that were ATF4-dependent in
D
o
suggest that insulin increases levels of these mouse L cells. This effect was also blocked by w
n
anabolic mRNAs by increasing ATF4 expression. rapamycin. Taken together, these data suggest lo
a
d
that the expression of ATF4 and ATF4-dependent ed
mTORC1 Mediates Insulin’s Effect on ATF4 and mRNAs may be a generalized effect of mTORC1 fro
m
Downstream mRNAs - The positive effect of activation. h
ttp
insulin on protein synthesis requires the ://w
mammalian target of rapamycin complex 1 DISCUSSION w
w
(mTORC1), a ubiquitously expressed protein .jb
c
kinase complex (29,30). Rapamycin, a highly These studies identify ATF4 as an anabolic .o
rg
specific chemical inhibitor of mTORC1 (31), was transcription factor that is subject to opposing b/
y
used to test whether mTORC1 might be part of a regulation by glucocorticoids and insulin. The g
u
e
signaling pathway that links insulin to ATF4. finding that ATF4 is required for expression of st o
Figure 5A shows that rapamycin reduced levels of mRNAs encoding amino acid biosynthetic n A
p
AmTRFN4A sm RinN Ase raunmd- sptarorvteeidn manodu sAe TLF 4-cdeellpse, ndtheunst etRnzNyAm essy, natmheitnaos easc iids tnraont spsuorrpterriss inangd. amIt iniso awcyell-l ril 4, 2
0
mimicking the effect of glucocorticoids. established that levels of many of these mRNAs 1
9
Moreover, in dexamethasone-treated L cells, are increased in a cell autonomous manner when
rapamycin blocked the insulin-mediated increase cells are deprived of amino acids, and that ATF4 is
in ATF4 mRNA, ATF4 protein, and ATF4- required for this increase (12-15). However, it
dependent mRNAs (Fig. 5B). These data indicate was not previously known that ATF4 and the
that activity of mTORC1 is required for high downstream mRNAs comprise an anabolic
levels of expression of ATF4 and ATF4-dependent program regulated by hormones that mediate the
mRNAs. mammalian responses to fasting and feeding
Mouse embryonic fibroblasts (MEF cells) (glucocorticoids and insulin, respectively). This
and C2C12 mouse myotubes were used to test suggests an important role for ATF4 in anabolism,
whether ATF4 might be a downstream target of and more specifically, in protein synthesis and cell
mTORC1 in other cell lines. When MEF cells are growth.
deprived of serum, mTORC1 is less active (32), The data are consistent with the model
and under these conditions, only a small amount of shown in Fig. 7. Under catabolic conditions, the
ATF4 protein was present (Fig. 6A). The addition presence of glucocorticoids and the absence of
of serum, which is known to increase mTORC1 insulin signaling reduce ATF4 expression.
activity (32), increased levels of ATF4 mRNA and Because ATF4 is required for the expression of
protein, as well as levels of several representative mRNAs encoding amino acid transporters, amino
7
acid biosynthetic enzymes and aminoacyl-tRNA amino acids (Gln, Glu, Asp and Ala) is uncoupled
synthetases, levels of these mRNAs fall. from the regulation of all of the other amino acids.
Conversely, under anabolic conditions, insulin Two additional pieces of data support this
signaling overrides the effect of glucocorticoids, hypothesis. First, reduction of ATF4 expression
thereby increasing levels of ATF4 and the specifically reduced free intracellular levels of Ser,
downstream mRNAs. Thus, insulin and Gly, Pro and the essential amino acids, with no
glucocorticoids regulate anabolic mRNAs for discernable effect on the levels of Ala, or the
amino acid and protein anabolism through combined levels of Gln + Glu or Asp + Asn.
combined effects on the GR and ATF4. This Second, the mRNA encoding one amino acid
contrasts with the mechanism by which catabolic biosynthetic enzyme, Glul, was increased by
mRNAs are regulated, through effects of insulin glucocorticoids and repressed by insulin, and thus
and glucocorticoids on the GR and Foxo proteins was reciprocally related to expression of the
(3-8). ATF4-dependent enzymes.
Importantly, insulin’s effect on ATF4 Why might Glul be upregulated by
occurs in the continued presence of glucocorticoids and downregulated by insulin?
glucocorticoids, which is consistent with the Glul plays at least two key roles in catabolism,
opposing yet interdependent, yin-yang relationship when peripheral cells break down protein and
of glucocorticoids and insulin: by promoting amino acids as a source of energy. First, by
D
catabolism and inhibiting anabolism, physiologic conjugating NH + to Glu, Glul removes free NH + ow
4 4 n
concentrations of glucocorticoids prime cells for that is generated when amino acids are lo
a
d
insulin, which dominantly reverses the effects of catabolized. Second, Glul generates Gln, which is ed
glucocorticoids on metabolic gene expression (11). then exported into the circulation and taken up in fro
m
This priming effect of glucocorticoids is also seen the liver or kidney. In liver and kidney, the amino h
ttp
in vivo. A common practice in the study of insulin groups of Gln contribute to the formation of urea ://w
action in whole animals is to first subject the or urinary NH +, respectively, whereas the carbon w
4 w
animals to a period of fasting prior to re-feeding, skeletons of Gln may be used as an energy source .jb
c
which then induces an overshoot of insulin or to generate glucose via gluconeogenesis. Ala .o
rg
secretion and action (34). However, this plays a similar role under catabolic conditions. On b/
y
overshoot response to re-feeding is absent not only the other hand, perhaps the ATF4-dependent g
u
e
in insulin-deficient animals, but also in animals amino acids (Asn, Gly, Ser, Pro and the 12 st o
that lack glucocorticoids. In adrenalectomized essential amino acids) are kept at a lower level n A
p
aandimminaliss,t rtahteio onv oefr sehxooogt erneospuos ngsleu ciso croesrttoicroeidd sb y(3 t4h)e. usynndtehre csaist aabnodl icce cllo gnrdoiwtiothn.s in order to limit protein ril 4, 2
0
One of the functional consequences of The model in Fig. 7 also shows that 1
9
ATF4 expression is to maintain intracellular amino insulin’s effect on ATF4 is mediated through
acid levels. Intracellular amino acid levels are mTORC1, a protein kinase complex with a
tightly regulated through a complex interplay of ubiquitous and essential role in protein synthesis
several processes including: the synthesis of and cell growth. The molecular pathways
nonessential amino acids; the import, export and downstream of mTORC1 are just beginning to be
degradation of essential and nonessential amino defined (29,30). To date, the best-characterized
acids; and protein synthesis and degradation. The downstream substrates of mTORC1 are p70 S6
ATF4-dependent mRNAs identified through the kinase 1 (S6K1) and the tumor-suppressor 4EBP1;
current RNAi experiments in mouse L cells phosphorylation of these two proteins by
encode three amino acid transporters that together mTORC1 rapidly stimulates ribosomal translation
are sufficient for the cellular uptake of all essential of mRNAs (29, 30). But other downstream targets
amino acids, and seven enzymes involved in the certainly exist, and the current data suggest that
synthesis of the nonessential amino acids Asp, ATF4 is one of them. This idea is also supported
Gly, Ser and Pro. Thus, the ATF4-dependent by a previous microarray analysis of interleukin-
mRNAs appear to directly regulate only 16 of the stimulated lymphocytes, in which the mTORC1
20 amino acids. This suggests the interesting inhibitor rapamycin repressed expression of
possibility that regulation of the remaining 4 mRNAs encoding amino acid transporters, amino
8
acid biosynthetic enzymes and aminoacyl-tRNA mRNA translation. Consistent with this idea,
synthetases (35). Thus, the existing data suggest amino acid deprivation, like insulin, not only
that these mRNAs (and likely ATF4) are increases ATF4 translation, but also increases
generalized downstream targets of mTORC1. ATF4 mRNA levels (39).
Regulation of ATF4 allows mTORC1 to couple The mechanism by which glucocorticoids
the uptake and synthesis of amino acids and decrease ATF4 mRNA and protein levels is also
synthesis of charged tRNAs (mediated through not yet clear. The simplest interpretation of the
ATF4) to global mRNA translation (mediated current data is that glucocorticoids inhibit
through regulation of S6K1 and 4EBP1). mTORC1 activity, a conjecture that is supported
It is perhaps important to note that insulin by the recent finding that glucocorticoids induce
(and thus mTORC1 activation) increased protein expression of Redd-1, a protein known to inhibit
synthesis and ATF4 mRNA prior to the induction mTORC1 activity (40).
of ATF4-dependent mRNAs. By increasing ATF4 Although the current data indicate that
expression, mTORC1 sets in motion a series of ATF4 is required for expression of anabolic
events that presumably allow cells to acquire and mRNAs encoding amino acid transporters, amino
generate amino acids and aminoacyl-tRNAs acid biosynthetic enzymes and aminoacyl-tRNA
needed for continued protein synthesis and cell synthetases, it is not yet known if ATF4 alone is
growth. sufficient. For example, the induction of Slc7a1
D
o
An unresolved question is how mTORC1 mRNA under conditions of amino acid deprivation w
n
activity increases levels of ATF4 protein. The appears to require a heterodimeric complex of lo
a
d
current data indicate that at least part of the ATF4 and C/EBPβ (another bZIP family member) ed
mTORC1 effect on ATF4 is mediated at the (41). C/EBPβ also plays an important role in the fro
m
mRNA level, either through stabilization or induction of the Asns gene under conditions of h
ttp
increased transcription of ATF4 mRNA. amino acid deprivation (42). It will be important ://w
mTORC1 might also have a post-transcriptional to determine whether C/EBPβ or another factor (or w
w
effect on ATF4. Previous studies have insulin-mediated event) might also be required for .jb
c
demonstrated that the stability and activity of the effect of ATF4 on anabolic mRNAs. .org
ATF4 protein is regulated post-translationally The current studies have focused on how b/
y
through phosphorylation (23,36), acetylation (37) hormones regulate ATF4 and mRNAs for amino gu
e
and ubiquitination (23,36-37). In addition, acid and protein anabolism. However, the mouse st o
translation of ATF4 mRNA is stimulated when L cell system might also be useful for the study of n A
p
caunlyt uornede omf athmem easlsieannt iafilb armobilnaos tas ciadrse, odre psruibvjeedc teodf ogtluhceor cpoartthicwoaiydss anandd p roincseuslsiens. th aFt oarre irnegstualnacteed, biny ril 4, 2
0
to ER stress (12-15,38). Both of these conditions mouse L cells, hormonal control of metabolic 19
activate eIF2α kinases, which inhibit global, processes is closely linked to cell survival.
nonspecific mRNA translation, but paradoxically Physiologic concentrations of glucocorticoids
promote ATF4 mRNA translation via an internal dramatically increased cell survival, while
ribosomal entry site in the ATF4 transcript. inducing transcriptional changes that are
In the current studies, insulin increased suggestive of a fasting response (induction of
ATF4 expression in association with an increase in catabolic genes and repression of anabolic genes).
global protein synthesis. Because eIF2α kinases Moreover, all of these effects of glucocorticoids
increase ATF4 but decrease global protein on cell survival and metabolic gene expression in
synthesis, this finding may suggest that eIF2α mouse L cells were blocked by insulin signaling,
kinases and mTORC1 increase ATF4 protein which also has the effect of preventing longevity
levels by different mechanisms. However, it also in whole animals (43). Although the effect of
leaves open the possibility that mTORC1 activity, glucocorticoids on cell survival was unexpected, it
by increasing global protein synthesis, might is perhaps not surprising in retrospect. Because of
induce a state of relative amino acid deprivation or their anti-anabolic and catabolic effects,
ER stress within cells, which then activates the glucocorticoids are essential for mammalian
eIF2α kinase-dependent pathway for ATF4 survival when caloric intake is limited, and are
thus 2-3-fold elevated when mammal are subjected
9
to caloric restriction, an intervention that induces caloric restriction in mammals, and further studies
metabolic quiescence and longevity by an focused on this possibility might help us
undetermined mechanism (44-46). This raises the understand the relationships between caloric
question of whether glucocorticoids might mediate intake, hormones, metabolism and lifespan.
at least some of the lifespan-promoting effects of
REFERENCES
1. Foster, D.W., and McGarry, J.D. (1996) In Textbook of Endocrine Physiology, J.E. Griffin and
S.R. Ojeda, S.R, ed. (New York, NY: Oxford University Press), p. 309-332
2. Leung, K., and Munck, A. (1975) Annu. Rev. Physiol. 37, 245-272
3. Sandri, M., Sandri, C., Gilbert, A., Skurk, C., Calabria, E., Picard, A., Walsh, K., Schiaffino, S.,
Lecker, S.H., and Goldberg, A.L. (2004) Cell 117, 399-412
4. Stitt, T.N., Drujan, D., Clarke, B.A., Panaro, F., Timofeyva, Y., Kline, W.O., Gonzalez, M.,
Yancopoulos, G.D., and Glass, D.J. (2004) Mol. Cell 14, 395-403
5. Furuyama, T., Kitayama, K., Yamashita, H., and Mori, N. (2003) Biochem. J. 375, 365-371
6. Kwon, H.-S., Huang, B., Unterman, T.G., and Harris, R.A. (2004) Diabetes 53, 899-910
D
o
7. Hall, R.K., Yamasaki, T., Kucera, T., Waltner-Law, M., O’Brien, R., and Granner, D.K. (2000) J. w
n
Biol. Chem. 275, 30169-30175 lo
a
d
8. Puigserver, P., Rhee, J., Donovan, J., Walkey, C.J., Yoon J.C., Oriente, F., Kitamura, Y., ed
Altomonte, J., Dong, H., Accili D., and Spiegelman, B.M. (2003) Nature 423, 550-555 fro
m
9. Saltiel, A.R. and Kahn, C.R. (2001). Nature 414, 799-806 h
ttp
10. Accili, D., and Arden, K.C. (2004). Cell 11, 421-426 ://w
11. Pilkis, S.J., and Granner, D.K. (1992) Annu. Rev. Physiol. 54, 885-909 w
w
12. Harding, H.P., Zhang, Y., Zeng, H., Norova, I., Lu, P.D., Calfon, M., Sadri, N., Yun, C., Popko, .jb
c
B., Paules, R., Stodji, D.F., Bell, J.C., Hettmann, T., Leiden, J.M., and Ron, D. (2003) Mol. Cell .o
rg
11, 619-633 b/
y
13. Kimball, S.R., and Jefferson L.S. (2005) Sem. Cell Develop. Biol. 16, 21-27 g
u
e
14. Kilberg, M.S., Pan, Y.-X., Chen, H., Leung-Pineda, V. (2005) Annu. Rev. Nutr. 25, 59-85 st o
n
15. Jousse, C., Averous, J., Bruhat, A., Carraro, V., Mordier, S., Fafournoux, P. (2004) BBRC 313, A
16. 4H4e7tt-m4a5n2n , T., Barton, K., and Leiden, J.M. (2000) Dev Biol 222, 110-123 pril 4, 2
0
17. Masuoka, H.C., and Townes, T.M. (2002) Blood 99, 736-745 1
9
18. Yang, X., Matsuda, K., Bialek, P., Jacquot, S., Masuoka, H.C., Schinke, T., Li, L., Brancorsini,
S., Sassone-Corsi, P., Townes, T.M., Hanauer, A., and Karsenty, G. (2004) Cell 117, 387-398
19. Lobel, P., Fujimoto, K., Ye, R.D., Griffiths, G., and Kornfeld, S. (1989) Cell 57, 787-796
20. Willnow, T., and Herz, J. (1994) J. Cell Sci. 107, 719-726
21. Horton, J.D., Shah, N.A., Warrington, J.A., Anderson, N.N., Park, S.W., Brown, M.S., and
Goldstein, J.L. (2003) PNAS 100, 12027-12032
22. Liang, G., Yang, J., Horton, J.D., Hammer, R.E., Goldstein, J.L., and Brown, M.S. (2002) J.
Biol. Chem. 277, 9520-9528
23. Yang, X., and Karsenty, G. (2004). J. Biol. Chem. 279, 47109-47111
24. Adams, C.M., Reitz, J., De Brabander, J.K., Feramisco, J.D., Li, L., Brown, M.S., and Goldstein,
J.L. (2004) J. Biol. Chem. 279, 52772-52780
25. Pratt, W.B., and Aranow, L. (1966) J. Biol. Chem. 241, 5244-5250
26. Sarraj, J.A., Vinson, C., and Thiel, G. (2005) Biol Chem. 386, 873-879
27. Eagle, H. (1955) J. Biol. Chem 214, 839-852
28. Hyde, R., Taylor, P.M., and Hundal, H.S. (2003) Biochem. J. 373, 1-18
29. Sarbassov, D., Ali, S.M., and Sabatini, D.M. (2005) Curr. Opin. Cell Biol. 17, 596-603
30. Wullschleger, S., Loewith, R., and Hall, M.N. (2006) Cell 124, 471-484
10
Description:expression of key genes needed for anabolic and catabolic processes. opposing yet interdependent, yin-yang relationship of glucocorticoids and