Table Of ContentHindawi
Mediators of Inflammation
Volume 2018, Article ID 3508506, 17 pages
https://doi.org/10.1155/2018/3508506
Research Article
In Vitro
Extraction Process, Component Analysis, and
Antioxidant, Antibacterial, and Anti-Inflammatory Activities of
Abutilon theophrasti
Total Flavonoid Extracts from Medic. Leaves
Chunlian Tian , Peng Zhang, Caixia Yang, Xiang Gao, Hong Wang, Yuru Guo,
and Mingchun Liu
KeyLaboratoryofZoonosisofLiaoningProvince,CollegeofAnimalScienceandVeterinaryMedicine,ShenyangAgricultural
University,No.120DonglingRoad,ShenheDistrict,Shenyang,LiaoningProvince110866,China
CorrespondenceshouldbeaddressedtoMingchunLiu;[email protected]
Received 7 November 2017; Revised 4 January 2018; Accepted 24 January 2018; Published 13 March 2018
AcademicEditor:AdoneBaroni
Copyright©2018ChunlianTianetal.ThisisanopenaccessarticledistributedundertheCreativeCommonsAttributionLicense,
whichpermitsunrestricteduse,distribution,andreproductioninanymedium,providedtheoriginalworkisproperlycited.
TheflavonoidfractionwasextractedfromtheleavesofAbutilontheophrastiMedic.,whichareusuallyusedasatraditionalChinese
herbalmedicineforthetreatmentofinflammationandjointpain.Thecurrentstudyfocusedontheextractionprocess,component
analysis, and in vitro antioxidant, antibacterial, and anti-inflammatory activities of the flavonoid fraction as a part of ongoing
researchonbioactivesubstancesfromnaturalplantsources.ThisstudyevaluatedtheantioxidantactivitiesviaassaysofDPPH
radicalscavengingcapacity,ABTSradicalscavengingcapacity,andreducingpowerandinvestigatedinhibitoryactivitiesagainst
Escherichia coli, Salmonella, Staphylococcus aureus, and Streptococcus. Moreover, the inflammatory activity of the flavonoid
fraction was estimated by measurement of the content of tumor necrosis factor alpha, interleukin-1-beta, interleukin-6,
interleukin-10, nitric oxide, and cyclooxygenase-2 and the gene expression levels of several inflammation markers, such as
inducible nitric oxide synthase and cyclooxygenase-2, in RAW 264.7 macrophages after LPS treatment. In addition, the
underlying anti-inflammatory mechanisms, that is, the activation of nuclear factor kappa B (NF-κB) and mitogen-activated
protein kinase (MAPK) signaling pathways, were also revealed from the gene and protein expression levels. Taken together,
these results suggested that the flavonoid fraction might exert in vitro antioxidant, antibacterial, and anti-inflammatory effects
on LPS-stimulated RAW 264.7 macrophages and will be potentially useful as an adjuvant treatment for oxidative stress and
bacterialandinflammatorydiseases.
1. Introduction oldage,diabetes,livercirrhosis,cancer,blooddiseases,che-
motherapy, radiotherapy, immune suppressants, hormones,
Oxidative stress, which is an important factor that leads to and antibiotics. Under these circumstances, the body is
aginganddiseases,canbeproducedbyexcessivefreeradicals vulnerabletobacteria,eventhosethatareweaklypathogenic.
[1–4]. Therefore, the elimination of harmful free radicals is Therefore,antibioticsareusuallyafirstchoicefortreatment
aneffectiveapproachforbalancingtheinternalenvironment of infectious diseases induced by bacterial or pathogenic
andpreventingrelateddiseases.Syntheticantioxidants,such microorganisms. However, their adverse effects, such as
asbutylatedhydroxytoluene(BHT)andbutylhydroxyanisd anaphylaxis [7, 8], intestinal flora alteration [9, 10], and, in
(BHA), have been applied widely in the food, pharmaceuti- particular,drugresistance[11,12],areoftenoverlooked.
cals,cosmetic,andmanufacturingindustries.However,stud- Inaddition,inflammation,whichisamajordefensereac-
ies have shown that these antioxidants produce adverse tionoftheimmunesystem[13]toharmfulstimuli,including
reactions,resultingindiseasesandbehavioralchanges[5,6]. infectionandinjury,isaseriousthreattohealth[14,15]and
Furthermore, the body’s resistance declines and is existsinmanydiseases,suchasbronchitis,pneumonia,gas-
accompanied by the various influential factors, including tritis, nephritis, and rheumatism. At present, steroidal and
2 MediatorsofInflammation
nonsteroidalanti-inflammatorydrugsarecommonlyusedin temperaturefor30daysandwerethengroundtoafinepow-
clinics;nevertheless,theirsideeffects,suchasgastrointestinal derbeforeextraction.
tractdamage[16,17]andallergicreactions [18–20],cannot
′
beignored. 2.2. Chemicals and Reagents. 2,2-Azino-bis(3-ethylbenzo-
Briefly, oxidative damage, bacterial infection, and thiazoline-6-sulfonic acid diammonium salt) (ABTS), 2,2-
inflammation are relatively typical clinical symptoms in diphenyl-1-picrylhydrazyl (DPPH), and 2,4,6-tri(2-pyri-
many diseases. However, increasing attention has been dyl)-s-triazine (TPTZ) were purchased from Sigma-Aldrich
given to adverse drug reactions. Therefore, it is necessary Chemie(Steinheim, Germany). Escherichia colilipopolysac-
to carry out research for the development of natural, charide(LPS),dimethylsulfoxide(DMSO),and3-(4,5-dime
green pharmaceuticals. thylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)
Abutilon theophrasti Medic. (A. theophrasti) is grown were purchased from Sigma-Aldrich (St. Louis, MO, USA).
widelyinthetropicsandsubtropics,suchasChina,Vietnam, Interleukin-1 beta (IL-1β), IL-6, IL-10, and tumor necrosis
India,Japan,Europe,andNorthAmerica[21],andisrichin factor alpha (TNF-α) Elisa kits were obtained from
potentiallyimportantbioactivecompounds,includingflavo- eBioscience (Science Center Drive San Diego, CA, USA).
noids, phenolics, organic acids, polysaccharides, saponins, COX-2 Elisa kit was purchased from Axygen (Central Ave-
amino acids, and coumarin [22–24]. Moreover, this plant nueUnionCity,CA,USA).AntibodiesagainstIκBα,p-IκBα,
hasbeenutilizedinfolktreatmentsforulcers,swell,venom, NF-κBp65,p-NF-κBp65,p38α,p-p38α,JNK1/2,p-JNK1/2,
inflammation, and pain [25–27]. However, the antioxidant, ERK1/2,p-ERK1/2,andβ-actinwerepurchasedfromSanta
antibacterial, and anti-inflammatory activities of A. theo- Cruz Biotechnology (Santa Cruz, CA, USA), and secondary
phrastileaveshavenotbeenextensivelyinvestigated. antibodies were obtained from Sangon Biotech (Shanghai,
Preliminary studies showed that A. theophrasti roots, China). Other chemicals and reagents were all analytically
stems, leaves, seeds, and episperm are rich in flavonoids pure and obtained from Sinopharm Chemical Reagent Co.
andthattheleavescontainthehighestcontentoftotalflavo- Ltd.(Shanghai,China).
noids[24].Itiswellknownthatflavonoidshaveawiderange
2.3. Instruments. LC-MS/MS analysis was performed on
of biological activities and pharmacological effects, such as
anAgilent1100seriesHPLC(PaloAlto,CA,USA)equipped
antioxidant, antibacterial, anti-inflammatory, anticancer,
with a G1311A quaternary pump, a G1313A high-
and antiviral activities and effects [28–33]. To evaluate
performanceautosampler,aG1379Ain-linedegasser,anda
the therapeutic potential of the flavonoid fractions of
G1316A thermostatted column compartment. The mass
medicinal herbs, A. theophrasti leaves, traditionally used
spectrometer was an Agilent Ion Trap MSD SL instrument
in China, were studied for their antioxidant, antimicrobial,
equipped with an atmosphere pressure chemical ionization
and anti-inflammatory activities against free radicals, path-
(APCI) source coupled with an electrospray ionization
ogenic bacteria, and inflammation induced by LPS in
(ESI) interface. Instrument operation, data acquisition, and
RAW 264.7 cells. Moreover, anti-inflammatory mecha-
processing were performed by MassHunter Workstation
nisms were further revealed by analysis of the expression
software (version B.03.01, Agilent). Chromatograph separa-
of genes and proteins that are associated with nuclear
tion was carried out by liquid chromatography coupled to
factor kappa B (NF-κB) and mitogen-activated protein
diode array detection (LC-DAD) analysis. UV spectra were
kinase (MAPK) signaling pathways.
recordedinarangeof210–400nmandmonitoredat350nm.
Therefore,theobjectivesofthispaperwere(a)toinvesti-
gate the process of extracting the flavonoid fraction of A. 2.4. Preparation of Extract. A suitable amount of A. theo-
theophrastileavesbysingle-factorexperimentsandresponse phrasti leaf powder was accurately weighed and extracted
surface method; (b) to identify thechemical componentsin witha42.28%ethanolsolution,a30:1(ml/g)ratioofsolvent
the extract by HPLC-DAD-ESI-MSn; (c) to evaluate the to material, and an ultrasonic-assisted extraction time of
in vitro antioxidant, antibacterial, and anti-inflammatory 30min at room temperature. The extraction solution was
activitiesofthetotalflavonoidextract(TFE);and(d)toana- firstfilteredthroughquantitativefilterpaper,andthemedic-
lyze the anti-inflammatory mechanisms that are associated inalmaterialresiduewasfurtherextractedonetimebyusing
withtheNF-κBandMAPKsignalingpathways. thesameextractionsolvent,ratioofsolventtomaterial,and
ultrasonic-assisted extraction time. The two filtrates were
pooledtogetherandthenevaporatedtoyieldasolidresidue
2. Materials and Methods
byrotaryevaporator.Thesolidresiduewasdissolvedwitha
°
proper solvent and stored in a refrigerator (4C) until used
2.1. Plant Collection. A. theophrasti leaves were collected foranalysis.
from Jilin Province of China in August, September, and
October (numbers 1408, 1409, and 1410, resp.) and were 2.5.TotalFlavonoidContent.Totalflavonoidcontent(TFC)
authenticated by Professor Jingming Jia of Shenyang Phar- was measured by a colorimetric method [34] with minor
maceutical University according to the Compendium of modifications, and rutin was used as a standard. The chro-
Materia Medica. The voucher specimens KT/JL/CH/AT/08/ mogenic reaction system consisted of aluminum nitrate,
14, KT/JL/CH/AT/09/14, and KT/JL/CH/AT/10/14 were sodium nitrite, and sodium hydroxide. A total of 5ml of
deposited at our laboratory for future reference. The leaves extractsolution(0.05g/ml)wasaddedina10mlvolumetric
were washed and dried in a shady and dry place at room flask and then mixed with 0.3ml of 5% sodium nitrite
MediatorsofInflammation 3
solution. After reaction for 6min at room temperature, activitywasexpressedastheIC (mg/ml),whichistheTFE
50
0.3ml of 10% aluminum nitrate solution was added, and concentrationthatinhibits50%ofthefreeradicals.
then,4mlof4%sodiumhydroxidesolutionwasaddedafter
2.7.2. DPPH Radical Scavenging Activity Assay. The DPPH·
reactingforanother6min.Finally,thevolumeofthereaction
radical scavenging activity of TFE was measured by the
solution was increased to 10ml with ethanol. The reaction
method described by [36] with modifications. A total of
solution was mixed thoroughly and incubated for 20min at
0.1mlofdifferentconcentrationsofsamplewasmixedwith
room temperature. After high-speed centrifugation for
0.9ml of 0.1mmol/l DPPH radical ethanol solution. The
6min, the absorbance of the supernatant was measured at
°
510nm.TFCwasdefinedasfollows:extractionyieldoftotal mixture was shaken and incubated for 30min at 37C in a
flavonoids(w/w)(%)=massoftotalflavonoidsexpressedas water bath in the dark, and the absorbance of the resulting
solution was assayed at 517nm. The values of IC were
mgofrutinequivalentspergdryweightofA.theophrastileaf 50
determinedasreportedabove.
sample(mgRE/gDW).Alltestswereperformedintriplicate,
andthemeanswerecalculated.
2.7.3. Ferric-Ion Reducing Antioxidant Power Assay. The
ferric-ion reducing antioxidant power (FRAP) of TFE was
2.6.FlavonoidsCompositionsAnalyzedbyHPLC-MS
measured by the method of Pajak et al. [37] with modifica-
2.6.1. Sample Preparation for HPLC-MS Analysis.A total of tions. Briefly, the FRAP reagent was a mixture of acetate
0.5g of A. theophrasti leaf powder was extracted with the buffer (pH3.6), 20mmol/l FeCl , and 10mmol/l TPTZ in
3
optimumextractionconditionsanddriedbyvacuumrotary 40mmol/l HCl at 10:1:1 (v/v/v). An aliquot of 0.1ml of
evaporation to yield a solid residue. The solid residue was different concentrations of TFE was added to 0.4ml of
dissolved with 10ml of chromatographic methanol (Merck FRAP reagent, the solution was incubated in the dark for
°
Serono Co. Ltd., Germany), centrifuged (2000rmp), and 30min at 37C in a water bath, and the absorbance was
filtered with a 0.22μm microfiltration membrane prior to measured at 593nm. The values were expressed as mmol
LC-DADandLC-MSanalysis. Fe2+ per 100μg/ml of TFE. All determinations were per-
formed in triplicate.
2.6.2. LC-MS/MS and LC-DAD Conditions and Parameters.
2.8.DeterminationofAntimicrobialActivity
ThemoleculeswereseparatedonaC column(Dikmaplat-
18
inumseries,250mm×4.6mm,i.d.5μm)usingthefollowing
2.8.1. Microbial Strains. The standard strains of Escherichia
mobile phase: (A) acetonitrile and (B) water formic acid
coli (ATCC 25922), Salmonella typhimurium (ATCC
0.1%.LCseparationconditionsconsistedofanisocraticstep
51812), Staphylococcus aureus (ATCC 25923), and Strepto-
at 0–45% of A for 0–45min and then 45–0% of A for 45–
coccus pneumoniae (ATCC 49619) were obtained from
50min, with a flow rate of 700μl/min. The HPLC-ESI-MS/
AmericanTypeCultureCollectionandstoredattheDepart-
MSoperatingconditionswereasfollows:negativeandposi-
ment of Animal Pharmacy, College of Animal Science and
tive ion modes, automatic secondary mass spectrum scan
VeterinaryMedicine,ShenyangAgriculturalUniversity.
witha scanning range of50–1000m/z, drying gas with12l/
°
min and 350C, nebulizer pressure of 30psi, and a capillary 2.8.2. Bacterium Solution Preparation. Escherichia coli, Sal-
voltageof3500V. monella typhimurium, Staphylococcus aureus, and Strepto-
ForLC-DADanalysis,thesamechromatographiccondi- coccus pneumoniae were inoculated onto MacConkey agar
tionsdescribedforLC-MS/MSanalysiswereemployed,with medium,SSagarmedium,hypersaltmannitolmedium,and
theexceptionofaninjectionvolumeof20μl. improved Edward medium, respectively. For Streptococcus,
rabbit blood (without fibrin) was added to the culture
2.7.DeterminationofChemical-BasedAntioxidantActivities mediumtoproduceafinalconcentrationof5%.Afterover-
night culture, the four standard strains were adjusted to 0.5
2.7.1. ABTS Radical Scavenging Activity Assay. The ABTS
McFarland turbidity standards (1×108CFU/ml) and were
radicalscavengingactivityofTFEfromA.theophrastileaves
thendilutedtoaratioof1:1000withsterilenutrientbroth.
wasassayedbythemethodofDawidowiczandOlszowy[35]
withminormodifications.TheABTSradicalcation(ABTS+)
2.8.3. Sample Solution Preparation for Antibacterial Activity
wasobtainedinareactionof7mmol/lABTSand2.45mmol/
Assay.TFEwaspreparedwithoptimalextractiontechnology
l potassium persulfate. After the mixture was incubated at
and was dissolved in sterile water to obtain an initial stock
roomtemperatureinthedarkfor12–16h,theABTSsolution
solution concentration of 2.0g of raw medicinal material/
wasdilutedwithPBStoobtainanabsorbanceof0.700±0.02
ml. Ten serial twofold dilutions of the stock solution were
at734nm.Atotalof0.1mlofdifferentconcentrationsofTFE prepared to produce a final concentration of 1.0 to 0.002g
wasmixedwith0.9mloftheABTSsolution,andtheabsor-
ofrawmedicinalmaterial/ml.Thestocksolutionconcentra-
bance of the resulting solution was measured at 734nm tionofgentamicinwas1.28mg/ml,andthefinalconcentra-
after a 30min incubation period at room temperature in tionrangedfrom0.25to128μg/ml.
a water bath in the dark. The scavenging effect was calcu-
lated by the following equation: radical scavenging rate 2.8.4.AntibacterialActivityAssay.Antibacterialactivitywas
(%)=[(A −A )/A ]×100%, where A and A are the screened by the microwell dilution method as described by
0 1 blank 0 1
absorbanceoftheABTSsolutionandABTSsolutionwithsam- Jaradat et al. [38] with modifications, and the MIC values,
pleatdifferentconcentrations,respectively.Theantioxidant definedasthelowestconcentrationofsamplesshowingclear
4 MediatorsofInflammation
wellsorwithcompleteinhibitionofbacteria,werechosenas adequately,andthen,themixturewasdilutedto100mlina
theprimaryevaluationindicators.Briefly,eachwellofa96- volumetricflask.
well plate was filled with 100μl TFE solution and 100μl of TopreparesolventB,0.1gofn-naphthylethylenediamine
bacterium solution and was completely mixed. The plates was dissolved fully in deionized water and diluted to a vol-
°
were covered and incubated at37C for 24h.The antibiotic umeof100ml.
gentamicinandsterilewater(inasimilarvolumeasthetest The NO content was assayed by the Griess reagent
sample) were used as the positive and negative controls, methodwithmodificationsdescribedbySuetal.[40].Briefly,
respectively.Eachexperimentwasperformedintriplicate. 50ml of different concentrations of sodium nitrite standard
diluents and the supernatant was reacted with 50ml of
2.9.DeterminationofAnti-InflammatoryActivityAssay solvent A and incubated at 37°C for 10min. Then, 50ml of
solventBwasadded,andthemixturewasincubatedagainat
2.9.1. Cell Culture. RAW 264.7 cells belonging to a murine 37°Cfor10min.Afterincubation,theabsorbancewasmea-
macrophagecelllinewerepurchasedfromtheShanghaiCell suredat540nm.TheconcentrationofNOwascalculatedfrom
BankoftheChineseAcademyofSciences(Shanghai,China). an established sodium nitrite standard curve. The data are
ThesecellswereculturedinRPMI1640mediumcontaining representativeofthreeindependentexperiments.
10% fetal bovine serum, 100U/ml penicillin, and a strepto-
mycinmixturewithsupplemented5%CO at37°C. 2.9.5.MeasurementofCytokineSecretion.Theproinflamma-
2
tory cytokines TNF-α, IL-1β, and IL-6 and the anti-
2.9.2. Sample Solution Preparation for Anti-Inflammatory inflammatorycytokineIL-10fromthesupernatant ofRAW
Activity. TFE solution was prepared with the optimized 264.7 cell cultures were assayed by ELISA kits according to
extractionprocessandwasdissolvedcompletelywithRPMI the manufacturer’s instructions. Briefly, 100μl of diluted
1640mediumatafinalconcentrationof13.14mg/ml.Then, captureantibodywasaddedtoeachwellandincubatedover-
TFEsolutionwasfiltered,packed,andpreservedat−20°Cfor night at 4°C. After the supernatant was discarded, the wells
lateruse. were washed 4 times with a special ELISA lotion. For each
wash, the wells were soaked for approximately 1min, and
2.9.3. Cell Viability MTT Assays. The cytotoxicity of TFEin theremainingfluidwassubsequentlyremovedwithblotting
RAW 264.7 cells was evaluated using the MTT assay based paper.Next,200μlofsamplediluentwasaddedtoeachwell,
on the conversion of MTT into formazan crystals in living and the plate was sealed with single-use sealing membrane
cells[39].Inbrief,cellswerecultured in96-wellplateswith andincubatedfor1hat37°C.Then,100μlofeightdifferent
4×104cells/welluntilconfluent.Afteronehourincubation, concentrations of standards and culture supernatant was
the cells were grouped into a negative control group, an added to each well and mixed with 100ml of diluted detec-
LPSmodelgroup,andthreetestgroupswithfinalTFEcon- tion antibody, and the plate was then incubated for 1h at
centrations of 50, 100, and 200μg/ml, respectively. Then, 37°C. After washing, 100μl of horseradish peroxidase was
50μlofLPS(1μg/ml)wasaddedtotheLPSmodelgroupand added, and the plate was sealed for a 30min incubation.
threetestgroups,and50μlofRPMI1640mediumwasadded Then,100μloftetramethylbenzidinecolordevelopingagent
tothenegativecontrolgroup.Afterallgroupswereincubated wasaddedandincubatedfor15min.Finally,everywellwas
for18h,20μlofMTTreagent(5mg/ml)wasadded,andeach reacted with 50μl of stop buffer, and absorbance was mea-
wellwasincubatedfor4h.Then,150μlofdimethylsulfoxide suredat450nmusingamicroplatereader.Thecytokinecon-
wasmixedafterdiscardingthesupernatantandshakengently, centrations were calculated from a standard curve on the
followedbymicroplatereaderdetectionat570nm.Dataare basisofabsorbancevalues.
representativeofthreeindependentassays.
2.9.6.TotalRNAExtractionandGeneExpressionLevelAssay
2.9.4. MeasurementofCOX-2 andNO. Intotal,4×105cells by Quantitative Real-Time PCR. Total RNA of RAW 264.7
were seeded into 96-well plates. After incubation for 1h, cells was extracted with TRIzol reagent (Vazyme Biotech
50μl of LPS (1μg/ml) was added to the LPS model group Co.Ltd.,USA)accordingtothemanufacturer’sinstructions,
andthreetestgroups,and50μlofRPMI1640mediumwas and gene expression levels were quantified by quantitative
added to the negative control group. The supernatant was real-timepolymerasechainreaction(qRT-PCR)asdescribed
collectedformeasurementofCOX-2andNOaftertreatment previously [41]. PCR products were analyzed by a spectro-
for18h. photometer (DU 730, Beckman Coulter, USA) and 1%
agarose gel electrophoresis for quality control. The expres-
(1) COX-2 Measurement. The content of COX-2 in the cul- sion level of mRNA was analyzed using an IQTM5 Optical
turesupernatantwasquantifiedusinganELISAkitinaccor- Module fluorescence quantitative gene amplification instru-
dance with the manufacturer’s instructions. The OD values ment (Bio-Rad, USA). RNA was reverse-transcribed into
weremeasuredat450nm.Afterstopbufferisadded,quanti- cDNAaccordingtotheoperatinginstructionsofthereverse
ficationmustbecompletedwithin15min. transcription reaction system and was used as a template
for amplification by PCR. The fluorescence qRT-PCR
(2) NO Measurement. To prepare solvent A, 1.0g of anhy- primer sequences (sequence 5′–3′) are shown in Table 1.
drous sulfanilic acid, 6ml of 85% phosphoric acid, and After normalization with β-actin (internal control), fold
70ml of deionized water were mixed and dissolved changes in the expression levels of target mRNAs (COX-2,
MediatorsofInflammation 5
Table1:TheprimersequencesoffluorescenceqRT-PCR.
Genes Primerdirection Primersequences(5′–3′) Reannealingtemperature(°C) Productsize(bp)
Forward AGCCAGGCAGCAAATCCTT
COX-2 60 169
Reverse GGGTGGGCTTCAGCAGTAAT
Forward GGTGAAGGGACTGAGCTGTT
iNOS 60 103
Reverse ACGTTCTCCGTTCTCTTGCAG
Forward GCCATCCCAGGCAGTATCTA
IκB 60 106
Reverse TTCCAAGACCAGACCTCCAG
Forward GACCTGGAGCAAGCCATTAG
p65 60 123
Reverse CACTGTCACCTGGAAGCAGA
Forward CTATGGCTCGGTGTGTGCT
p38α 60 115
Reverse GACGCAACTCTCGGTAGGTC
Forward TGTTCCCCGATGTGCTTTT
JNK 59.7 147
Reverse CGTTGATGTATGGGTGCTG
Forward GCGGCTGAAGGAGTTGAT
ERK1/2 60 119
Reverse CAGGTAGGAGCAGGACCAGA
Forward GTGCTATGTTGCTCTAGACTTCG
β-Actin 60 174
Reverse ATGCCACAGGATTCCATACC
iNOS, IκB, p65, p38α, JNK, and ERK1/2) were calculated Table 2: Independent variables and the levels used in the
usingthe2−△△CTmethod. Box-Behnken design.
Levels
2.9.7. Protein Extraction and Western Blot Analysis. RAW Independentvariables −1 0 1
264.7cellsandtestsamples(finalTFEconcentrationsof50,
Extractiontime(A,min) 20 25 30
100, and 200μg/ml) were incubated with RPMI 1640
medium for 1h and then induced with LPS (1μg/ml) for Concentrationofethanolsolution(B,%) 30 40 50
Ratioofsolventtomaterial(C,ml/g) 20 25 30
30min. After the supernatant was discarded, the cells were
washedtwicewithprecooledPBSandthendisruptedwitha
mixtureofcelllysisbufferandphenylmethanesulfonylfluo-
° Table3:TheBox-Behnkendesignmatrixandresponsevaluesfor
ride(v:v,9:1;1.0mlperwell)for2-3hat4Cfortheextrac-
TFEyields.
tion of total proteins. Cell lysates were centrifuged at
14,000×g for 15min at 4°C, and then, the supernatant was
Variablelevels Response1
collectedforfurtheranalysis.Thetotalproteinconcentration Run A B C (R1)
wasmeasuredbyaBCAproteinassaykit(CWBIOBiotech-
1 25 40 25 1.09
nology Co. Ltd., Beijing, China) according to the manufac-
turer’sinstructions. 2 20 30 25 1.04
3 20 40 20 1.02
The protein samples were separated by sodium dodecyl
sulfate-polyacrylamide gelelectrophoresis (SDS-PAGE)and 4 30 30 25 1.02
transferred to polyvinylidene fluoride (PVDF) membranes 5 25 30 30 1.21
(SolarbioTechnologyLtd.,Beijing,China).ThePVDFmem- 6 30 40 20 1.17
braneswereblockedwith5%skimmedmilkinTBSTbuffer
7 30 40 30 1.29
containing 0.05% Tween 20 for 1h and then incubated for
8 25 40 25 1.08
°
2h at 37C. Subsequently, the membranes were incubated
° 9 20 40 30 1.16
sequentiallyat4Covernightwithprimarymonoclonalanti-
bodies, including IκBα, p-IκBα, NF-κB p65, p-NF-κB p65, 10 25 40 25 1.09
p38α, p-p38α, JNK1/2, p-JNK1/2, ERK1/2, p-ERK1/2, and 11 25 50 30 1.09
β-actin (Santa Cruz Biotechnology Co. Ltd., USA). After 12 20 50 25 0.85
washing3–5times,themembraneswereincubatedcontinu- 13 25 40 25 1.08
ously with secondary antibodies labeled with horseradish 14 25 50 20 1.07
°
peroxidasefor2hat37C.Finally,chemiluminescencedetec-
15 30 50 25 1.18
tion was conducted using an ECL assay kit (Beyotime Bio-
16 25 30 20 1.00
technologyCo.Ltd.,Shanghai,China),andtheimageswere
17 25 40 25 1.09
captured using a Micro Chemic Gel Doc XR (Bio-Rad,
6 MediatorsofInflammation
Table4:ANOVAfortheresponsesurfacequadraticmodelofTFEyields.
Source Sumofsquares DF Meansquare Fvalue pvalue,prob>F Significant
Model 0.15 9 0.017 299.31 <0.0001 Significant
A 0.044 1 0.044 771.11 <0.0001 ∗∗
∗∗
B 0.0008 1 0.0008 14.18 0.0070
C 0.030 1 0.030 531.87 <0.0001 ∗∗
AB 0.031 1 0.031 542.72 <0.0001 ∗∗
AC 0.0001 1 0.0001 1.77 0.2248
BC 0.009025 1 0.009025 159.94 <0.0001 ∗∗
A2 0.00001684 1 0.00001684 0.30 0.6018
B2 0.018 1 0.018 320.13 <0.0001 ∗∗
C2 0.022 1 0.022 386.81 <0.0001 ∗∗
Residual 0.000395 7 0.00005643
Lackoffit 0.000275 3 0.00009167 3.06 0.1544 Notsignificant
Pureerror 0.00012 4 0.00003
Cortotal 0.15 16
R2 0.9974
AdjR2 0.9941
PredR2 0.9699
Adeqprecision 76.154
CV% 0.69
∗∗p≤001.
USA).Therelativelevelsoftargetproteinsweredetermined extractioncycles. Asone influencefactorwasevaluated,the
based on the optical density of the electrophoresis bands, middlelevelswerechosenfortheothertwofactors.Thefil-
withβ-actinservingasaninternalcontrol. trate was concentrated to 10ml prior to the measurement
ofTFC.
2.10. Statistical Analysis. Experiment values are means of
three replicate samples (n=3). All experiment results were (2) Optimization of Extraction Conditions by a Box-
expressed as means±standard deviation. The RSM experi- Behnken Design. On the basis of the single-factor experi-
ment data were analyzed by Design Expert 8.0.6 software, ments, three levels were confirmed for the three factors,
andotherexperimentdatawereanalyzedstatisticallybySPSS and then, a Box-Behnken design (BBD) of three variables
17.0(SPSS17.0forWindows;SPSSInc.,Chicago,IL).Inall (A, extraction time; B, concentration of ethanol solution;
statistical analyses, p values≤0.05 were regarded as statisti- and C, ratio of solvent to material) and three levels
callysignificantandpvalues≤0.01asverysignificance. (Design-Expert software, Trial Version 8.0.6, State Inc.,
Minneapolis, USA) was introduced to optimize the extrac-
3. Results and Discussion tion procedure of the flavonoid fraction from A. theo-
phrasti leaves. The independent variables and the ranges
3.1.OptimizeExtractionConditionsforTotalFlavonoids of their levels are listed in Table 2, and the yield of the fla-
vonoid fraction was considered the dependent variable. As
3.1.1.ExperimentalDesign
shown in Table 3, the BBD consisted of twelve factorial
points and five replicates of central points in the response
(1)SingleFactorExperiments.Accordingtorelatedliterature
[42–44] and preliminary single-factor and response surface surface experiment, and the experimental runs were ran-
experiments, three major influence factors, namely, the domized to minimize the effects of unpredictable variabil-
ity in the observed responses.
extraction time (A, min), concentration of ethanol solution
(B,%),andratioofsolventtomaterial(C,ml/g),wereinves-
tigated for optimum extraction, and the yields of the flavo-
3.1.2.OptimizationofExtractionConditionsbyBBD
noid fraction from A. theophrasti leaves were determined
usinganinspectionindex.Theflavonoidfractionswerepre- (1) Model Fitting and Statistical Analysis. As shown in the
paredonthebasisofthefollowingfactors:concentrationof designmatrix(Table3),17experimentswereperformedwith
ethanolsolution(20%,40%,60%,80%,and100%),extraction theyieldoftheflavonoidfractionfromA.theophrastileaves
time(10,15,20,25,and30min),andratioofsolventtomate- asanindex.Thedatawereanalyzedstatisticallybymultiple
rial (10:1, 15:1, 20:1, 25:1, and 30:1ml/g) in two regression analysis using Design Expert software (version
MediatorsofInflammation 7
1.3 1.3
1.2 1.2
1.1 1.1
1 1 1 1
R R
0.9 0.9
0.8 0.88
(B) 5C0o.n0c0ent4r5at.0io0n o4f 0e.t0h0ano3l 5so.0lu0tio3n0.00 20.0022.002(4A.)0 0E2x6tr.a0c0t2io8n. 0ti03m0e.00 3(C0.)0 R0a2ti8o. 0o0f s2o6lv.0e0nt2 t4o. 0m0a2te2r.i0a0l20.00 20.0022.002(4A.)0 0E2xt6r.a0c0ti2o8n .t0i0m3e0.00
(a) (b)
1.3
1.2
1.1
1 1
R
0.9
0.88
30.00
(C) Rati2o8 o.0f 0s2o6lv.0en02t 4to.0 m02a2te.0ri0a2l0.00 30.(0B0) Co3n5c.0e0ntrat4i0o.n0 0of et4h5a.n0o0l so5lu0t.i0o0n
(c)
Figure1:(a–c)Responsesurfaceplotsshowingtheeffectofextractiontime(A,min),concentrationofethanolsolution(B,%)andratioof
solventtomaterial(C,ml/g)onTFEyield.
Table 5: TFC (%) and IC values for evaluating antioxidant 1
50 2250
assays and EC values for reducing power of TFE from A.
50 2000
theophrasti leaves. 1750
1500
TFC IC IC EC50FRAP U) 1250
Number (%) (μ5g0/AmBlT)S (μ5g0/DmPlP)H (m0.1mμogl/Fme2l)+/ (mA 1075000
Aug.sample 1.29±0.02 3.10 8.96 0.33 500 3
Sep.sample 1.31±0.01 2.95 8.41 0.41 250 2 4 56 7
0
Oct.sample 0.83±0.02 5.31 14.41 0.23
0 10 20 30 40 50
BHT — 2.25 8.11 0.14
(min)
IC :inhibitionconcentration50%.
50
Figure 2: Chromatographic profile at 350nm of TFE of A.
8.0.6) to obtain the following flavonoid fraction final equa- theophrastileaves.
tionintermsofcodedfactors:
Y=109+0074A−001B+0061C+0088AB−0005AC (Table 4), only 0.26% of total variance cannot be explained
−0047BC+0002A2−0066B2+0072C2 bythemodel,andtheadjustedR2at0.9941demonstrateda
better correlation between theexperimental valuesand pre-
1 dictedvalues.Inaddition,thelowerpvalue(p≤00001)sug-
gested that the model significantly represents the true
According to the calculated coefficient (R2=0.9974) relationship between the parameters and the response. Fur-
obtained by ANOVA of the quadratic regression model thermore, a lower coefficient of variation (CV) of 0.69
8 MediatorsofInflammation
Table6:ThemajorcompoundsinTFEidentifiedbyHPLC-DAD-ESI-MSnanalysis.
Peak Rt [M-H]− [MMS−/MHS]− [M+H]+ [MMS+/MHS]+ Calmcualsasted Formula Proposedmolecule Referencesb
1a 30.1 609 463,301 611 465,303 610 C H O Rutin [24]
27 30 16
2 31.5 463 301 465 303 464 C H O Quercetin-7-O-β-glucoside [49]
21 20 12
Kaempferol3-O-α-
3 32.3 593 447,285 595 449,287 594 C H O rhamnopyranosyl(1→6)- [49]
27 30 15
β-glucopyranoside
4 32.5 285 — 287 — 286 C H O Luteolin [24]
15 10 6
5 41.3 593 447,285 595 449,287 594 C H O Apigenin-7-O-β-diglucoside [46]
27 30 15
6 42.1 593 447,285 595 449,287 594 C H O Poncirin [47]
27 30 15
7 48.7 593 447,285 595 449,287 594 C H O Tiliroside [48]
27 30 15
aPeaknumberasinFigure2.bThereferencecolumnreferstopreviousreportsonmetabolitesindifferentplants.
indicatesthebetterprecision,accuracy,reliability,andrepro- Table7:Correlationcoefficientsbetweenassays.
ducibilityofthemodel.
ANOVA was applied to evaluate the significance of the ABTS DPPH FRAP TFC(%)
regression coefficients of the response surface quadratic ABTS 1 1.000∗ −0.920 −1.000∗
regressionmodel.AsshowninTable4,thelinearcoefficients
and quadratic term coefficients of the extraction time (A), DPPH — 1 −0.930 −0.999∗
concentration of ethanol solution (B), and ratio of solvent FRAP — — 1 0.912
to material (C) were all very significant (p≤001). Further- TFC(%) — — — 1
more, there were very significant differences (p≤001) in ∗Significantatp≤005.
theinteractionsbetweenAandBandbetweenBandC,while
no significant linear and quadratic effect was observed yield of TFE relative to the extraction time and to the ratio
betweenAandC(p>005).Inaddition,B2andC2hadavery ofsolventtomaterialwasnotsignificant(p>005).
significant (p≤001) influence on the yield of the flavonoid The extraction yield gradually increased with increasing
fraction, which indicated that the influence factors did not concentrations of ethanol solution reaching a maximum at
haveasimplelinearorquadraticrelationship(Table4). 42.8% and finally declined within the range of 42.8 to 50%
(Figure 1(c)). However, the yield was positively correlated
(2) GraphicalInterpretation and Optimization of Procedure. with the increasing ratio of solvent to material from 20
Therelationshipbetweentheresponseandtheexperimental to 30ml/g. The mutual interaction between the ethanol
levelforeachofthethreefactorswasvisualizedbythesurface concentration and the ratio of solvent to material was very
andcontourplotsonthebasisofthederivedequations,and significant (p≤001). The above results were in accordance
theoptimumconditionsforthemaximumyieldofTFEcould with the ANOVA test.
bededuced.
AsshowninFigure1,theextractionyieldofTFEfromA. (3) Optimization of Extraction Parameters. Because of the
theophrasti leaves can also be predicted by the three- optimum extraction conditions that were visually observed,
dimensional (3D) response surface and two-dimensional the extraction processing parameters were optimized by a
(2D) contour plots of extraction time (A), concentration of response surface methodology instead of by the orthogonal
ethanol solution (B), and ratio of solvent to material (C), test(60% ethanol solution, ratioofsolventtomaterial 30:1
whichinfluencetheyieldofTFEtowithdifferentdegrees. (ml/g),andextractiontime20min)thatwaspublishedprevi-
Figure1(a)showsthattheinteractionbetweentheextrac- ously [45]. The processing parameters were optimized by
tiontime(A)andconcentrationofethanolsolution(B)hada Design-Expert software as follows: extraction time 30min;
verysignificantinfluence(p≤001)ontheyieldofTFEwhen concentration of ethanol solution 42.28%; and ratio of sol-
theratioofsolventtomaterial(C)waskeptatamiddlelevel. vent to material 30:1. For operational convenience, the
TheexperimentalresultsdemonstratedthattheyieldofTFE concentration of ethanol solution was adjusted to 42.3%.
increasedwhentheextractiontimewasincreasedfrom20to The experiments were performed in triplicate under the
30min.However,comparedtothegrowthrateincreasefrom revised conditions, and the yield (1.31±0.01%) was only
20to25min,theextractionyieldincreasedslowlyfrom25to slightly higher than the predicted result (1.29%), indicating
30min. In consideration of the time, cost, and test index, a good correspondence between the experimental and
30minwassetasthelongestextractiontime. predicated values.
Theextractiontime(A)andtheratioofsolventtomate-
rial(C)hadminoreffectsontheTFEyield(Figure1(b)).The 3.1.3. TFC of A. theophrasti Leaves. The flavonoid fraction
extractionyieldincreasedwithchangesintheextractiontime from A. theophrasti leaves was extracted by conditions that
(A)from20to30minandintheratioofsolventtomaterial were optimized with model equations, and the yields of the
from 20 to 30ml/g. However, the interaction effect for the flavonoid fractions were 1.29±0.02%, 1.31±0.01%, and
MediatorsofInflammation 9
Table8:MICvaluesofTFEfromA.theophrastileavesagainstpathogenicbacteria(mean±SD;n=3).
Escherichiacoli Salmonella Staphylococcusaureus Streptococcus
Sample
(ATCC25922) (ATCC51812) (ATCC25923) (ATCC49619)
Gentamicin(μg/ml) 2.00±0.02 0.50±0.01 0.50±0.01 1.00±0.01
TFE(gcrudedrug/ml) 1.02±0.04 0.51±0.02 0.06±0.01 0.26±0.01
0.83±0.02%forthesamplescollectedinAugust,September,
0.8
and October 2014, respectively (Table 5). The results indi-
cated that there was a clear correlation between TFC and
themonthinwhichthemedicinalmaterialswereharvested.
0.6
TheorderofTFCfromA.theophrastileavesindifferenthar- D)
vest months was as follows: September>August>October. O
nTahlisefinnvidrionngmsuengtgeasntsdthinatteTrnFaCl mphigyhsitobloegrieclaaltefadcttoortsh.eTehxetreer-- ability ( 0.4
vi
fore, it is necessary to choose an appropriate time for ell
collecting medicinal materials to be used for research on C 0.2
the pharmacological action and content of active compo-
nentsofTFC.
0.0
3co.2m. pCohneemnitcsalprCesoemnptoinnenTtFAEnwaleyrseisidoefnTtiFfiEed. Tanhde cahneamlyizceadl ontrol LPS mlTFE mlTFE mlTFE mlTFE mlTFE mlTFE
byHPLC-DAD-ESI-MSninpositiveandnegativeionmodes. C g/ g/ g/ g/ g/ g/
휇 휇 휇 휇 휇 휇
The UV chromatogram was recorded at 350nm (Figure 2) 0 0 0 0 0 0
5 5 0 0 0 0
and exhibited peaks of multiple heights. The mass and MS/ PS + S + 1 1 S + 2 2
MS fragmentation patterns obtained from the electrospray L P P
L L
mass spectra are shown in Table 6. Using this procedure, Different treatment groups
rutin, quercetin 7-O-β-glucoside, kaempferol 3-O-α-rham-
Control LPS + 100 휇g/mlTFE
nopyranosyl(1→6)-β-glucopyranoside, luteolin, apigenin
7-O-β-diglucoside, poncirin, and tiliroside were character- LPS 100 휇g/mlTFE
ized tentatively according to the literature [24, 46–49]. LPS + 50 휇g/mlTFE LPS + 200 휇g/mlTFE
This research will provide a foundation for the study of 50 휇g/mlTFE 200 휇g/mlTFE
the quality control methods and pharmacological effects
Figure3:EffectofTFEontheviabilityofRAW264.7cells.Cells
of TFE from A. theophrasti leaves. wereculturedwithTFE(50,100,and200μg/ml)intheabsenceor
presenceof1μg/mlLPSfor18h;then,cellviabilitywasmeasured
3.3. Antioxidant Activity Analysis. As described in Table 5, by MTT assay. Data are presented as means±SD of three
the highest antioxidant activity was measured in the Sep. independentexperiments.
sample, which had the lowest IC (2.95μg/ml) and
50 ABTS
IC (8.41μg/ml)andthehighestEC (0.41mmol
50DPPH 50FRAP
Fe2+/0.1μg/ml); followed by the Aug. sample, with IC
50
=3.10μg/ml, IC =8.96μg/ml, and EC higherthanthoseoftheOct.sample.Therefore,theyarelikely
ABTS 50 DPPH 50
=0.33mmolFe2+/0.1μg/ml;andfinallyOct.sample,with tobeabletosubstituteforsyntheticantioxidants.Therefore,A.
FRAP
IC =5.31μg/ml, IC =14.41μg/ml, and EC theophrastileavesshouldbeagoodcandidatefortheresearch
50 ABTS 50 DPPH 50
=0.23mmolFe2+/0.1μg/ml.ComparedtotheBHTposi- anddevelopment ofhealthyandnatural antioxidants inthe
FRAP
tivecontrol,withIC 2.25μg/ml,IC 8.11μg/ml, foodandpharmaceuticalindustries.
50ABTS 50DPPH
and EC 0.14mmol Fe2+/0.1μg/ml, the Sep. sample
50 FRAP
displayedmuchhigherFRAPandnearlyidenticalscavenging 3.4. Pearson Correlation Analysis between TFC and
abilitiesforDPPHandABTSfreeradicals.Furthermore,the AntioxidantActivity.Inthisresearch,theantioxidantactivi-
FRAPs of the Aug. and Oct. samples were approximately ties of TFE were investigated using assays of ABTS radical
2.4-fold and 1.7-fold stronger than BHT, respectively. scavenging activity, DPPH radical scavenging activity, and
The three antioxidant assays suggested that the antioxi- FRAP.Tofurtherunderstandtheinterrelationshipsbetween
dantactivitiesofTFEcorrelatedwiththemonthsduringwhich theantioxidantactivityandTFC,thePearsontestwasusedto
A.theophrastileaveswerecollected.Becauseoftheirreducing analyze the interaction between the two factors, and the
power, all three samples can replace synthetic antioxidant results of the correlations among the parameters are shown
BHT in the pharmaceutical and food industries. In view of in Table 7. The correlations were significant (p≤005)
thescavengingabilitiesoftheDPPHandABTSfreeradicals, between TFC and the antioxidant activity measured by the
theantioxidantactivitiesoftheAug.and Sep.samples were ABTS assay (r,−1.000) and between TFC andtheresults of
10 MediatorsofInflammation
800 30
##
600 ##
ml) ⁎ ⁎ ⁎ ml) 20
2 (pg/ 400 mmol/ ⁎⁎ ⁎⁎ ⁎⁎
OX- O (
C N 10
200
0 0
Different treatment groups Different treatment groups
Control 100 휇g/mlTFE Control 100 휇g/mlTFE
LPS 200 휇g/mlTFE LPS 200 휇g/mlTFE
50 휇g/mlTFE 50 휇g/mlTFE
(a) (b)
Figure 4: Effects of different concentrations of TFE on LPS induced COX-2 (a) and NO (b) production in RAW 264.7 cells. Cells were
pretreatedwithTFE(50,100,and200μg/ml)for1h,followedbyLPS(1μg/ml)stimulationfor18h.Valuesrepresentthemean±SDof
thethreeindependentexperiments(##comparedwiththecontrol,∗comparedwithLPS;∗p≤005and∗∗/##p≤001).
theDPPHassay(r,−0.999).Furthermore,therewasabetter 1.5
correlation (r, 0.912) between TFC and the values of the
FRAP assay, although the correlation was not significant
(p>005). These results indicated that TFC contributes
n 1.0
thoightherebaentwtieoexnidtahnet aancttiiovxitiydanatndacttihviatty tahned cToFrCre.lation is pressio
Table7alsoshowstheresultsofcorrelationsbetweenthe e ex ⁎⁎ ⁎⁎
tThFrEee.Amseitghnoidfiscaunstecdortoreleavtaioluna(tep≤th0e0a5n)tiwoxasidfaonutnadcbtievtiwtyeeonf Gen 0.5 ⁎⁎ ⁎⁎
theDPPHandABTSassays(r,1.000).Moreover,bettercor- ⁎⁎ ⁎⁎
⁎⁎ ⁎⁎
relations were found between FRAP and ABTS and FRAP
andDPPH,withrvaluesof−0.920and−0.930,respectively. 0.0
This implies that the correlations were much better for the COX-2 iNOS
three quantification methods of antioxidation activity of Different treatment groups
TFE, and theresults wereconsistentwiththoseof thethree
LPS 100 휇g/mlTFE
antioxidantassays.
Control 200 휇g/mlTFE
50 휇g/mlTFE
3.5.AntimicrobialActivityAnalysis.Theantibacterialactivi-
ties of TFE from A. theophrasti leaves against four bacteria Figure5:EffectsofdifferentconcentrationsofTFEonLPSinduced
strainsareshowninTable8.Gentamicin,asastandardanti- COX-2andiNOSgenesexpressioninRAW264.7cells.Cellswere
biotic,was used as apositive control toensure theaccuracy pretreated with TFE (50, 100, and 200μg/ml) for 1h, followed by
and reliability of the assay method for antibacterial activity. LPS(1μg/ml)stimulationfor18h.Valuesrepresentthemean±SD
As shown in Table 8, the order of the inhibitory effect of of the three independent experiments (∗∗compared with LPS;
TFEonthefourbacteriawasasfollows:first,Staphylococcus ∗∗/##p≤001).
aureus, with an MIC value of 0.06±0.01g crude drug/ml;
second, Streptococcus, with an MIC value of 0.26±0.01g 3.6.Anti-InflammatoryActivityAnalysis
crude drug/ml; third, Salmonella, with an MIC value of 3.6.1.EffectofTFEontheCellViability.Theinhibitoryeffect
0.51±0.02gcrudedrug/ml;andfinally,Escherichiacoli,with
ofTFEonRAW264.7cellgrowthwasevaluatedbytheMTT
an MIC value of 1.02±0.04g crude drug/ml. These results
assay.CellswereincubatedwithTFEatconcentrationsof50,
suggestedthattheinhibitoryeffectofTFEonthefourbacte- 100,and200μg/mlafterbeingpretreatedwithLPSormedium
riaisgreaterthanthatofgentamicin.Inaddition,theinhib- only. The results showed that cell viabilities (99.3–100.7%)
itoryeffectofTFEwasstrongeronthegram-positivebacteria werenotsignificantly(p>005)affectedbyTFEintheexperi-
than on the gram-negative bacteria. This study confirmed
mentalconcentrationrange(Figure3).
thatTFEexhibitspotentialantibacterialactivityandprovides
afoundationforresearchonreplacingordecreasingantibi- 3.6.2.EffectofTFEontheContentofCOX-2andNOandon
oticapplicationsintheclinic. the Genes Expression Levels of COX-2 and iNOS. Previous
Description:surface method; (b) to identify the chemical components in COX-2 Elisa kit was purchased from Axygen (Central Ave- . 0.1 ml of different concentrations of sample was mixed with. 0.9ml of .. as an index. [8] N. Urriola, L. Paganini, S. Riminton, and S. Limaye, “Oral . Bioprocess Engineering, vol