Table Of Content© Biodiversity Heritage Library, http://www.biodiversitylibrary.org/; www.zoologicalbulletin.de; www.biologiezentrum.at
Bonnerzoologische Beiträge Band 56 Heft4 Seiten 273-278 Bonn, November2009
Phylogeny of the genus Agama
DNA
based on mitochondrial sequence data
Adam D. Leachéi -, Rebecca A. Chong', Theodore J. Papenfussi, Philipp Wagner-\ Wolfgang Böhme^,
Andreas Schmitz-*, Mark-Oliver Rödel-\ Matthew LeBreton^, Ivan Ineich^, Laurent Chirio'', Aaron
Bauer^ Edem A. Eniang^ & SherifBaha El Din''
' Museum ofVertebrate Zoology, University ofCalifornia, Berkeley, CA, USA
- E-Mail: aleache@,ucdavis.edu
^ Zoologisches Forschungsmuseum Alexander Koenig, Bonn, Gennany
4 Muséum d'histoire naturelle. Department ofHeipetology and Ichthyology, Geneva 6, Switzerland
5 Museum flir Naturkunde at the Humboldt University Berlin, Gemiany
Ö Muséum national d'Histoire naturelle, Départment Systématique et Evolution (Reptiles), Paris, France
^ Department ofBiology, Villanova University, Villanova, PA, USA
^ Department ofForestiy and Wildlife, University ofUyo, Akwa Ibom State, Nigeria
9 3 Abdala El Katib St, Dokki, Cairo, Egypt
Abstract. Wepresentapreliminaryphylogeny for 19 speciesofAfricanAgama lizardsbasedona maximum likelihood
phylogeneticanalysisof1,181 bpofmitochondrialDNAsequencedata.MonophyleticradiationsofspeciesinEast,South
andWestAfricaaresupported,aswellasacladecontainingtwospecies(A. doiiaeandA.sankaranica)distributedacross
theSahelregion.WestAfricanpopulationsoíA.agamaareparaphyleticwithrespecttoA.fiiichifromwesternmostKenya,
providing further evidence for a biogeographic comdor between West and EastAfrica. Populations oíA. agama fonn
fourphylogeographicgroups,whichsuggeststhat.4. agamamaybecomposedofmultipleindependentevolutionarylin-
eages.
Keywords.Africa, phylogeography, Systematics,biogeography,Agama agama.
Introduction
African lizards in the genus Agama are among the most Thesebroadlydistributedtaxaposesomedifficultspecies
diverse and widespread terrestrial squamates in Africa, delimitation problems (Wagner 2007; Wagner et al.
makingthemanidealgroupfortestingbiogeographichy- 2008a, Wagner et al. 2008b) and require detailed phylo-
pothesesandconductingcomparativeecological andevo- geographic investigations.
lutionary studies. However, the robust phylogenetic
framework forAgama that is needed to meet these goals ThegoalsofourcollaborativeresearchonAgama lizards
is currently lacking. Constructing a phylogeny for Aga- are to combine our sainpling efforts from separate biodi-
ma requires detailed investigations ofphylogenetic rela- versity fíeldwork programs in different countries across
tionships across multiple spatial and temporal scales. In Africa to 1) infer a comprehensive molecular phylogeny
general, the higher-level relationships within theAgami- for the genus Agama, 2) resolve species limits in wide-
daearepoorlyunderstood(Maceyetal. 2006),anddense spread, non-exclusive taxa, 3) conduct phylogeographic
samplingwithinAgamaandotherAfricanandAsiantaxa investigations oftheA. agama and A. lionotus complex-
isnecessaryfortestingthemonophyly ofand identifying es, and4) describe new species, where wairanted. In this
the sistertaxontoAgama. Atthepopulation level, sever- paper, we present a preliminary phylogeny forthe genus
alwidespreadandpolytypic species, such asAgamaaga- Agama based on an analysis ofmitochondrial DNA se-
ma inWestAfricaandA. lionotusinEastAfrica, haveun- quencedata(mtDNA). hiaddition,weinvestigatethephy-
clearspecieslimits(Böhmeetal. 2005)andmaybecom- logeography oíA. agama across WestAfrica.
posed of multiple independent evolutionary lineages.
© Biodiversity Heritage Library, http://www.biodiversitylibrary.org/; www.zoologicalbulletin.de; www.biologiezentrum.at
274 Adam D. Leaché et al.: Phylogeny ofthe genusAgama
Material & Methods DNAwas extracted fromtissues followingthePureGene
Animal Tissue DNAIsolation Protocol (Centra Systems,
Atotal of 19 species oíAgama were included in the phy- hic). Twoportionsofthemitochondrial genomewerePCR
logenetic analyses (Table 1 ). We included 15 specimens amplified and sequenced, including a small fragment of
ofA. agama from 10 countries across West Africa to in- the 16S rRNAgene (16S) and a portion ofthe ND4 pro-
vestigate the phylogeographic relationships among pop- teincodinggene (ND4) andtheadjacenthistidine, serine,
ulations. We selected four species from theAgaminae to andleucinetRNAgenes. Oligonucleotideprimersusedfor
representoutgrouptaxa, mcXuámgAcanthocercusatricol- PCR and sequencing are provided in Table 2. The 16S
lis, Laiidakia stellio, Trapeliis mutabilis, andXenagama rRNAgene was PCR amplified for 30 cycles (95°C 30s,
tavlori. We rooted our phylogeny with Laudakia stellio. 58°C 30s, 72°C 50s) and the ND4 was amplified for 35
although we notethatthe higher-levelrelationships with- cycles (95°C 30s, 55°C 40s, 72°C 1 min). PCR products
in the Agaminae are poorly understood (Macey et al. were purified using ExoSAP-IT (USB Corp.). Cycle se-
2000; 2006). quencingproductswere ethanolprecipitated, andthen se-
quenced using an ABI 3730 automated sequencer.
CM MCZI8456I
GAZFMK73I85
GHMVZ2496I7
NEMVZ23889I
lOOl"—GH LSUMZH20336
~rMLAMNHI09799
P-/V\RZFMK76838
WestAfrica
^*-GH LSUMZH20085
Radiation
Agama
finchi
TD 29061
Agama "agama"^ GN ULM200
CM MCZI84562
NGMVZ253099
EG CAS207958
CM ZFMK8376I
—CM X3853
Agama planiceps
—Agama sankaranica
Agama doriae ]Sahel Radiation
—
100 Agama kaimosae
91 Agama mwanzae EastAfrica
100 •Agama lionotus Radiation
Agama rueppelli
54 Agama caudospinosa_
100 Agama aculeata
I
78 Agama armata
99 Agama hispida South Africa
100 •—Agama atra Radiation
100 62 Agama anchietae
— 'Agama weidlioizi
Agama boulengeri West/ North
100 •Agama impalearis Africa
I Agama spinosa
lOOj Xenagama taylori
Acanthocercus atricollis
Trapelus mutabilis
Laudakia stellio
'0.1 substitutions persite
Fig. 1. Phylogenetic relationships within the genus Agama based on a maximum likelihood analysis ofmtDNA sequence data
using the GTR+F model ofnucleotide substitution. Maximum likelihoodbootstrap values >50''o are shown.
© Biodiversity Heritage Library, http://www.biodiversitylibrary.org/; www.zoologicalbulletin.de; www.biologiezentrum.at
Bonnerzoologische Beiträge 56 275
Table 1. Voucher numbers and locality data forspecimens used in the study. All sequences are deposited in GenBank (Accessi-
onNos. GU128430- GU128502). Voucherabbreviations are as follows: CAS, CaliforniaAcademy ofSciences; MVZ, Museum
ofVertebrateZoology; ZFMK,ZoologischesForschungsinstitutundMuseum; MCZ, Museum ofComparativeZoology; LSUMZ,
Louisiana State University Museum ofNatural Science; ULM, University ofLouisiana at Monroe Museum ofNatural History;
AMNH, American Museum ofNatural History; AMB,Aaron M. Bauer personal collection; specimen numbers beginning or en-
dingwith"X", "I", or"TR", personal collectornumbers forauthors fromthe Muséumnational d'Histoire naturelle.
Species Locality Voucher
Agama aculeata Botswana, Kgalagadi District MVZ, IvMJ/o
Agamaagama Cameroon ZFMK 83761
Agama agama Cameroon, Mende, montsTakamanda A OOJJ
Agama agama Cameroon, Yaounde MCZ 184561
Agama agama Cameroon, Yaounde MCZ 184562
Agama agama hquatoriai Gumea, Bioko Island, Malabo CAS 207958
Agama agama Gabon, Barrage de Ichunbcle ZhMK 73 85
1
Agamaagama Ghana, GreaterAccra Region, Tesano LaUMZ, HzUjiO
Agamaagama G/"IhIana, XNTorttlhern nRegion, TB")uipe LSUMZ H20085
Agama agama Ghana, Volta Region MVZ, z4yo1 /
Agama agama Guinea, Diaragbela, Niger River ULM
Agama agama Mali AMNH 109799
Agama agama Mauritania, Selibabi ZHMK 76838
Agama agama Niger, Niamey MVZ 238891
Agama agama Nigeria, Cross RiverNational Park MVZ, zjjuyy
Agama agama Icnad, DOi zyuo 1
Agama anchietae Namibia, tvhon.xas District AMB 7582
Agama armata Tanzania Z'7Tr^\M^TK/' O84AC9\C9\(0\
Agama atra SouthAfrica, Northern Cape Province LAo 1934JJ
Agama boidengeri Mauritania,Nouakchott Dist. MVZ z3J/d4
Agama caudospinosa Kenya, Nam Moni ZhMK 83662
Agama doriae Cameroon, Daré Ville 4218 A
Agamafmchi Kenya, Malaba ZrMK 83653
Agama hispida SouthAtrica, Northern Cape Province A\/iR /Iviin
Agama impalearis Mauritania, Nouakchott District MVZ 235766
Agama kaimosae Kenya, Nandi ZFMK 83660
Agama lionotus Kenya, Nakuru ZFMK 83646
Agama mwanzae Kenya, Mara ZFMK 82076
Agamaplaniceps Namibia, Outjo Dist., Kamanjab AMB 7638
Agama nieppelli Somalia, Awdal Region MVZ 241340
Agamasankaranica Ghana, Volta Region MVZ 249656
Agamaspinosa Djibouti, Dikhil MVZ 236458
Agama weidhohi Senegal TR481
AcanthocercusatricoUis Uganda, Rukungiri District CAS 201726
Laudakiastellio Turkey,Antalya Province MVZ 230213
Trapeliis mutabilis Egypt ZFMK 64395
Xenagama taylori Somalia, Galbed Region MVZ 241356
Contiguous DNAsequences were aligned and editedus- Results
ing Sequencher v4.8, and multiple sequence alignments
were generated using Muscle v3.6 (Edgar 2004). The The maximum likelihoodanalysis ofthe combined mtD-
open reading frame for the ND4 gene was identified us- NAsequence data (1,181 characters) supports the mono-
ingMacCladev4.08 (Maddison & Maddison2005). The phylyofthegenusAgama(bootstrap= 100%; Fig. 1). The
16S rRNAalignmentincludedindel-rich loopregionsthat outgroup taxaXenagama tayloriandAcanthocercusatri-
could not be aligned unambiguously and were excluded coUisfonn astronglysupportedclade (bootstrap= 100%)
fromthephylogeneticanalysis. Phylogeneticrelationships thatissisterto Trapeliismutabilis. WithinAgama, aclade
were inferred using maximum likelihood using RAxML containing^, impalearis and^. spinosa is sisterto all re-
V7.0.4 (Stamatakis 2008), and iinplemented the GTR+F mainingAgama, although this relationship is not accom-
model ofnucleotide substitution. Support values for in- paniedby strongsupport (bootstrap <50%; Fig. 1). Some
ferredrelationshipswereestimatedfrom 100non-paramet- regionalspeciesassemblagesaremonophyletic, including
ric bootstrap replicates. a clade ofSouthern African species (A. aculeata, A. an-
© Biodiversity Heritage Library, http://www.biodiversitylibrary.org/; www.zoologicalbulletin.de; www.biologiezentrum.at
276 Adam D. Leaché etal.: Phylogeny ofthe genusAgama
-10° 0° 10° 20° 30°
-10° 0° 10° 20° 30°
Fig. 2. Pliylogeographic structure o'i Agama agama across sub-Saharan Africa. Samples oíAgama agama are labeled by coun-
try ill the unrooted phylogeny. The maximum likelihood phylogenetic analysis placesAgamaplaniceps sistertoAgamaagama.
chietcie,A. atiri,A. (irnuitii andA. hispida) and a clade of graphic groups (Fig. 2). The geographic proximity be-
EastAfrican species (A. kainiosae,A. imvauzae. A. Hono- tween samples is a poor predictor ofphylogenetic rela-
tiis, A. caitdospinosa andA. nieppelli), each ofwhich are tionships, and three of the four clades overlap spatially
strongly supported (bootstrap = 99% and 100%, respec- (Fig. 2). One ofthe most well sampled phylogeographic
tively; Fig. 1). Strong support is also provided foraclade groups withinA. agama extends acrossWestAfrica from
ofspecies distributed across the Sahel region ofsub-Sa- MauritaniatoGabon(Fig. 2). Twoothercladeswithbroad
haran Africa, including A. doriae and A. sankaranica distributions include a group extending from Guinea to
(bootstrap = 100%). Agamaplaniceps is sister to a clade Caineroonandanotherextendingfi^oinTchadtoKenya{A.
containingall 15 specimensof.4. agamaandA.Jinclu,al- finchi) (Fig. 2). Finally, aclade withamorerestricteddis-
though this relationship is weak (bootstrap < 50%; Fig. tribution includespopulations from southeasternNigeria,
1). The inteiTclationships among these major clades are westernCaineroon,andBioko Island(Equatoi"ialGuinea)
not suppoited by bootstrap values > 50%, except for a (Fig. 2).
strongly supported clade (bootstrap = 100%) containing
the Sahel species (A. doriae and A. sankaranica) and A.
planiceps, A. agama, andA. finchi (Fig. 1). Discussion
Populations ofAgama agama in West Africa are para- This study represents the first detailed molecular phylo-
phyleticwithrespecttoA.finchifromwesternmostKenya genetic investigation ofthe genusAgama. Monophyletic
(Fig. 1). Populations ofA. agama form four phylogeo- radiations ofAgama lizards occur in East Africa, South
© Biodiversity Heritage Library, http://www.biodiversitylibrary.org/; www.zoologicalbulletin.de; www.biologiezentrum.at
Bonnerzoologische Beiträge 56 277
Table2. Primersusedto amplify and sequence mitochondrial DNA.
Gene Primers Reference
CGCCTGTTTAACAAAAACAT
16S 16Sf: This study
CCGGTCTGAACTCAGATCACGT
16sR:
ND4:CACCTATGACTACCAAAAGCTCATGTAGAAGC
ND4 Arévalo et al. (1994)
LEU: ACCACGTTTAGGTTCATTTTCATTAC
Africa, the Sahel region, and even West Africa (Fig. 1), Thephylogeographic relationshipswithintheAgamaaga-
butreconstructingthebiogeographic history ofthe group ma complex exhibit a suiprising amount ofspatial over-
isimpededbyseveral factors. First, theinter-relationships lapbetweenclades. PhylogeographicstudiesofotherAga-
amongthemajorlineages ofAgaina inferredbythemtD- ma lizards, including A. impalearis (Brown et al. 2002)
NA data are not accompanied by strong support, which and.4. afra(Matthee& Flemming 2002)recoveredmore
wouldmakeanybiogeographic scenariosbasedonthecur- typical phylogeographic patterns whereby populations
rent phylogeny speculative. Second, our taxonomic cov- formed geographically exclusive clades. The spatial
erage is not comprehensive and lacks approximately 10 overlapofmtDNAclades intheA. agamacomplexcould
speciesthataredistributedthroughoutAfrica. Finally,the be evidence ofthe presence ofmultiple distinct species,
sistertaxonoiAgamaremainsunclear. Despitethesechal- which co-occurthroughout WestAfrica and are as ofyet
lenges, there are strong biogeographic signals in the cur- morphologically cryptic. Conversely, this spatial pattern
rent phylogeny (Fig. 1). For instance, the phylogenetic couldreflecttherecentexpansion ofdistinct lineagesthat
placement ofA. Jinchi from western Kenya within the were formerly restricted to exclusive geographic areas.
WestAfricanA. agama complex provides evidence for a Distinguishing among these differenthypotheses ofpop-
biogeographic corridor between West and East Africa, a ulationhistoryawaittheadditionofmorespecimens from
result that provides further evidence for a close biogeo- throughoutWestAfricaandthecollectionofnuclearDNA
graphic affinity between these regions (Wagner et al. data. This work is currently undei"way.
2008c). Inaddition,thecloserelationshipbetweenA.plan-
iceps fromNamibiaandtheWestAfricanA. agama com- The collaborative nature ofthis research project is pro-
plexprovides supportforabiogeographic connectionbe- viding an opportunity to conduct detailed investigations
tweenWestandSouthAfrica(Figs 1 and2). Thisrelation- ofthe phylogeny and phylogeography ofAgama lizards
ship is not surprising given the close similarity in mor- than would have otherwise been impossible. Our cuirent
phology and colourpattern sharedbetween these species workbenefits fromhavingexpandedtaxonomic sampling
(Böhme et al. 2005). and multiple individuals ofeach species, more detailed
outgroup sampling, densepopulationsamplingin^. aga-
The intraspecificphylogenyíorAgamaagamahighlights ?na and A. liouotiis species, and the addition ofnuclear
DNA
thetaxonomic problemsthatthiswidespreadtaxon intro- sequence data.
duces toAgama lizard systematics. This species is para-
phyletic with respect to A. finchi (Figs 1, 2) and appears Acknowledgements. We thankreviewersforuseful comments
tobecomposedofmultipledistinctclades. The argument on previous versions ofthis manuscript, and to curators at the
couldbemadethaiA.finchishouldbe synonymizedwith MVZ,CAS, MCZ,FMNH,AMNH,AMCC,and LSUMNS for
A. agamatoretainamonophyleticA. agama,butA. finchi tissue loans.
is clearly distinct based on morphology and coloration.
The majorphylogeographic groups found withinA. aga-
ma based on mtDNAmay represent distinct species, and References
representa good starting point fortesting species bound- Arévalo, E.,Davis, S. K. &J. W. Sites,Jr. (1994): Mitochon-
aries with multiple nuclearmarkers. Detennining ifgene drial DNAsequencedivergenceandphylogeneticrelationships
flow is absent among these mtDNA groups is an impor- amongeightchromosomeracesoftheSceloporusgrammiciis
tant next step in resolving the systematics oftheA. aga- complex(Phiynosomatidae)incentralMexico. SystematicBi-
macomplex.Theparaphylyof^. agamaalsounderscores Böohlmoeg,yW4.3,: W38a7g-n4e1r8,.P., Malonza, R, Loiters, S. & J. Köh-
the need for additional detailed comparative moipholog- ler(2005):AnewspeciesofXho.Agamaagamagroup(Squa-
ical investigations that do not rely solely on adult male mata:Agamidae)fromwesternKenya,EastAfrica,withcom-
coloration characteristics (see Grandison 1968). ments onAgama lionotiis Boulenger, 1896. Russian Journal
ofHerpetology 12: 143-150.
© Biodiversity Heritage Library, http://www.biodiversitylibrary.org/; www.zoologicalbulletin.de; www.biologiezentrum.at
278 Adam D. Leaché et al.: Phylogeny ofthe genusAgama
Brown, R. P., Suárez, N. M. & J. Pestaño (2002) The Atlas Matthee,C.a.&A. F.Flemming(2002): Populationfragmen-
mountainsasabiogeographicdivideinNorth-WestAfrica:ev- tationinthesouthernrockagama,Agamaatra: moreevidence
idence from mtDNA evolution in the Agamid lizardAgama for vicariance in Southern Africa. Molecular Ecology 11:
impalearis. Molecular Phylogcnetics and Evolution 24: 465-471.
324-332. Stamatakis, a. Hoover, P. & J. Rougemont (2008): Arapid
Edgar, R. C. (2004): MUSCLE: multiple sequence alignment bootstrap algorithm for the RAxML web-servers. Systemat-
with high accuracy and high throughput. Nucleic Acids Re- ic Biology 57: 758-771.
search32: 1792-1797. Wagner, P. (2007): Studies in African Agama I. On the taxo-
Grandison,a.G. C.(1968): Nigerian lizardsofthegenusAga- nomic status of Agama lionotiis usamharae Barbour &
ma(Sauria:Agamidae). BulletinoftheBritishMuseum(Nat- Loveridge, 1928. Herpetozoa 20: 69-73.
ural Histoiy) Zoology 17: 65-90. Wagner, R, Krause,R & W. BOhme (2008a): StudiesonAfri-
Macey, J. R., Schulte II, J. A., Larson,A.,Ananjeva, N. B., canAgama III. Resuirection ofAgama agama twuensis Lo-
Wang, Y., Pethiyagoda, R., Rastegar-Pouyani, N. & T. J. veridge, 1932(Squamata:Agamidae)fromsynonymyandele-
Papenfuss(2000): Evaluatingtrans-Tethysmigration: anex- vation to species rank. Salamandra44: 35^2.
ample using acrodont lizardphylogcnetics. Systematic Biol- Wagner, P., Burmann, A. & W. Böhme (2008b): Studies on
ogy49: 233-256. AfricanAgama II. Resurrection ofAgama agama kaimosae
Macey, J. R., Schulte II,J.A., Pong, J.A., Das, I. & T. J. Pa- Loveridge, 1935 (Squamata:Agamidae)fromsynonymyand
penfuss (2006): The complete mitochondrial genome ofan itselevation to speciesrank. RussianJournal ofHerpetology
agamid lizard from theAfro-Asian subfamilyAgaminae and 15: 1-7.
thephylogencticpositionofBiijonlcep.sand.Venagamu. Mol- Wagner,R,Köhler,J., Schmitz,A.&W. Böhme(2008c):The
ecular Phylogcnetics and Evolution 39: 881-886. biogeographicalassignmentofawestKenyanrainforestrem-
Maddison,W. R&D. R.Maddison(2005): MacClade4:Analy- nant: furtherevidencefromanalysisofitsreptilefauna.Jour-
sisofPhylogenyandCharacterEvolution. SinauerAssociates, nal ofBiogeography 35: 1349-1361.
Sunderland, MA.
ZOBODAT - www.zobodat.at
Zoologisch-Botanische Datenbank/Zoological-Botanical Database
Digitale Literatur/Digital Literature
Zeitschrift/Journal: Bonn zoological Bulletin - früher Bonner Zoologische Beiträge.
Jahr/Year: 2009
Band/Volume: 56
Autor(en)/Author(s): diverse
Artikel/Article: Phylogeny of the genus Agama based on mitochondrial DNA sequence
data 273-278