Table Of ContentArticle
Mobilization of Copper ions by Flavonoids in Human
Peripheral Lymphocytes Leads to Oxidative DNA
Breakage: A Structure Activity Study
HussainArif1,NidaRehmani1,MohdFarhan1,AamirAhmad2,*andSheikhMumtazHadi1,*
Received:14September2015;Accepted:30October2015;Published:9November2015
AcademicEditor:WilliamChi-shingCho
1 DepartmentofBiochemistry,FacultyofLifeSciences,AligarhMuslimUniversity,Aligarh202002,UP,
India;[email protected](H.A.);[email protected](N.R.);[email protected](M.F.)
2 KarmanosCancerInstitute,WayneStateUniversitySchoolofMedicine,Detroit,MI48201,USA
* Correspondence:[email protected](A.A.);[email protected](S.M.H.);
Tel.:+1-313-576-8315(A.A.&S.M.H.);Fax:+1-313-576-8389(A.A.&S.M.H.)
Abstract: Epidemiological studies have linked dietary consumption of plant polyphenols with
lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other
plant sources) induce apoptosis and cytotoxicity in cancer cells. These can therefore be used
as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In
the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the
structure–activity relationship of myricetin (MN), fisetin (FN), quercetin (QN), kaempferol (KL)
andgalangin(GN).Usingsinglecellalkalinegelelectrophoresis(cometassay), weestablishedthe
relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined
that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions
and the generation of reactive oxygen species. The relative DNA binding affinity order was
further confirmed using molecular docking and thermodynamic studies through the interaction
of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should
have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring
system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of
theflavonoids.
Keywords: flavonoids; cometassay; structureactivityrelationship; moleculardocking; Isothermal
TitrationCalorimetricMeasurements;hydroxylgrouppositions
1. Introduction
Development of cancer is a complex process that involves factors that are important in the
significantstepsofinitiation,promotionandprogression,resultingintheuncontrolledproliferation
andgrowthofcancercells. Itisnowbelievedthatdietaryfactorsfromvariousplantscanmodulate
the phenomenon of carcinogenesis, thus relating the food stuffs to benefits beyond the basic
nutritional requirements [1–3]. Among such dietary constituents, plant polyphenols are considered
to be the most effective in cancer chemoprevention in humans [4,5]. Flavonoids can be classified
under 14 different categories such as flavonols, flavones, flavanones, and others [6,7]. Structurally,
flavonoids are C6–C3–C6 compounds consisting of two benzene rings, joined by the C3 aliphatic
chainwithaheterocyclicpyranring[8]. Flavonoidsareasubclassofplantpolyphenolsthatinclude
flavonolslikemyricetin,fisetin,quercetin,kaempferolandgalangin. Themechanismbywhichthese
anticancer compounds are able to inhibit proliferation and induce apoptosis in cancer cells is not
veryclearlyunderstoodandhasbeeninvestigatedwithprofoundinterest. Inrecentyears,anumber
Int.J.Mol.Sci.2015,16,26754–26769;doi:10.3390/ijms161125992 www.mdpi.com/journal/ijms
Int.J.Mol.Sci.2015,16,26754–26769
of reports have suggested that a number of these flavonoids including myricetin, fisetin, apigenin
quercetin and kaempferol induce apoptotic cell death in cancer cell lines [9–12]. One particularly
interestingobservationisthatanumberoftheseflavonoidsinduceapoptosisandaffecttumorigenesis
incancercellsbutnotinnormalcells[13,14].
Previous reports from our laboratory have established that many classes of plant-derived
Int. J. Mol. Sci. 2015, 16, page–page
polyphenoliccompounds,includingflavonoids,canbringaboutoxidativestrandbreakageinisolated
quercetin and kaempferol induce apoptotic cell death in cancer cell lines [9–12]. One particularly
DNAorcellularDNAeitheraloneorinthepresenceoftransitionmetalionssuchascopper[15,16].
interesting observation is that a number of these flavonoids induce apoptosis and affect
It is well established that copper is an important and the most redox active metal ion when
tumorigenesis in cancer cells but not in normal cells [13,14].
compared to the other metal ions that are present in biological systems [17]. Copper is found in
Previous reports from our laboratory have established that many classes of plant-derived
chromaptionly,pchloensoelliyc acossmopcoiautnedds, winitchludDinNgA flabvaosneosi,dps,a rctainc ublrairnlgy athboeugt uoaxnidianteivbe asstera[n1d8 ]b.reMakoasgte flianv onoids
possessisboloatthed pDroNoAx iodra cnetllualsarw DeNllAa seitahnetri oaxloindea notr pinr othpee rptrieessen[1ce9 –o2f 1t]r.anEsiatirolnie mr,ewtale iopnrso psuocshe dast h at the
prooxidcaonpptecr y[1to5,t1o6x].i cIt iasc wtieolnl esotafbfllisahveodn tohiadt scomppiegrh ist abne imapvoretraynt iamndp tohret amnotstm reedcohxa ancitsivme ,mleetaald iionng to the
when compared to the other metal ions that are present in biological systems [17]. Copper is found
anticancer and apoptosis-inducing ability [5,22]. We proposed that such prooxidant mechanism
in chromatin, closely associated with DNA bases, particularly the guanine base [18]. Most flavonoids
against cancer cells involves mobilization of endogenous copper ions [5]. Among the metal ions,
possess both prooxidant as well as antioxidant properties [19–21]. Earlier, we proposed that the
theconpceronotxriadtaiontn coyftoitrooxnici sactthioenh oigf hfleasvtoinnoicdesl lms,igwhht ebree aa svceoryp pimerpoarntadntz imncecahraenitshme, mleaadjoinrgm teot athlse present
in the naunctilceaunsce[r1 a8n,2d3 ]a.poCpotopspise-irnidsukcinnog wabniltitoy p[5o,2s2se].s Ws he igprhoepsotsreedd tohxat ascutcivh itpyrowoxhidicahntf amceilcihtaanteissmi ts rapid
recyclinagg,aiinnstt chaencperre cseellns cinevooflvceos mmpoboiuliznadtisons uocf henadsogpelnaonuts pcooplypperh ieonnso [l5s].a Anmdomngo ltehce umlaetralo ixoyngs,e tnhe, leading
concentration of iron is the highest in cells, whereas copper and zinc are the major metals present in
to generation of reactive oxygen species (ROS) such as the hydroxyl radical. It may be mentioned
the nucleus [18,23]. Copper is known to possess highest redox activity which facilitates its rapid
that chromatin-bound copper can be mobilized by copper chelators such as 1,10-phelanthroline to
recycling, in the presence of compounds such as plant polyphenols and molecular oxygen, leading
cause internucleosomal DNA fragmentation [24]. A number of studies suggest that serum [25,26],
to generation of reactive oxygen species (ROS) such as the hydroxyl radical. It may be mentioned
tissue[2th7a]t acnhrdomcealtliunl-aborucnodp pcoeprpleerv cealns baer empoabriltiizceudl abryl ycohpipgehr icnhevlaatroirosu ssuccha nasc e1r,1s0[-2p8h]e.laSnuthcrholainme teoc hanism
is not dcaeupseen indteenrntuoclneorsoemceapl tDoNrAo rfrmagimtoecnhtaotinodnr [i2a4].m Ae dnuiamtebder pofr osgturdaimes msuegdgecset ltlhadt esaetrhum[2 [92]5.,26O], ver the
years, wtisesuhea [v27e] avnadli cdealltueldar ocouprphery lpevoetlhs easries pwarititchulcaorlnys hiidgehr ianb vlearisouucsc ceasnsce[r3s, 5[2,18]7. ,S2u2c,h3 0a] .meScphaenciisfimc ally, we
is not dependent on receptor or mitochondria mediated programmed cell death [29]. Over the years,
have shown that oxidative cellular DNA breakage by polyphenols involves mobilization of nuclear
we have validated our hypothesis with considerable success [3,5,17,22,30]. Specifically, we have
copper[30]. Moreover,overloadofcopperinlymphocytesresultsinincreasedpolyphenol-mediated
shown that oxidative cellular DNA breakage by polyphenols involves mobilization of nuclear
cellularDNAdegradation[31].Finally,wehavealsosuccessfullydemonstratedthatpolyphenolscan
copper [30]. Moreover, overload of copper in lymphocytes results in increased polyphenol-mediated
inhibitcgerloluwlatrh DoNfAm duelgtirpadleatcioann c[3e1r].t yFpineasllyin, wcue lhtuavree ;atlshoi ssuecffceescstfuisllyre ddeumcoendstsriagtendi fithcaatn ptloylyipnhtehneolps resence
ofcoppcearns ipnehcibifiitc gcrhoweltaht oorf sm,wulittihplec hcealnacteor rtsyopefsi rionn cualntudrez;i nthcisr eelfafetcivt eisl yreidnuecffeedc tsiivgneif[i3c2an–t3l4y ].in the
Plapnretspenocley opfh ceonppoelsr sipneccliufidc icnhgelafltoarvso, wnoitihd cshaelraetorras poifd irloynm anedt azbinocl irzeeladtivienlya inniemffeaclticveel [l3s2a–n34d]. thus have
Plant polyphenols including flavonoids are rapidly metabolized in animal cells and thus have
poor bioavailability [35]. However, as there is considerable literature on the anticancer properties
poor bioavailability [35]. However, as there is considerable literature on the anticancer properties
of flavonoids, it is reasonable to assume that flavonoids can be exploited as lead compounds for
of flavonoids, it is reasonable to assume that flavonoids can be exploited as lead compounds
the synftohr etshies syonfthneosvise olf cnoomvepl cooumnpdosunwdist hwiethn ehnahnacnecdedb biiooaavvaaiillaabbiliiltiyt.y T.akTinagk itnhgis itnhtios coinntsoidecroantisoind, eration,
we assewses eadsstehsseedc htehme icchaelmbiacsail sboafsist hoef ctyhteo tcoyxtioctoaxcict ivaicttyiviotyf dofi ffdeirfefenrtenflt afvlaovnooniodidss( m(myyrriicceettiinn,, fisetin,
quercetfiinse,tikna, eqmueprcfeetrionl, ,kgaeamlapnfgerionl), gaanldangeivna) luanadte edvatlhueatesdtr uthcet usrtreu-catcutriev-iatcytivrietyla trieolantisohnisphip(S A(SARR))o f these
of these compounds. For example, we show that the number and position of hydroxyl groups
compounds. For example, we show that the number and position of hydroxyl groups in the B-ring
in the B-ring of flavonoid skeleton (Figure 1a) is important in determining the cellular DNA
offlavonoidskeleton(Figure1a)isimportantindeterminingthecellularDNAdegradingcapacityof
degrading capacity of these compounds. The structures of various flavonoids used in this study are
thesecompounds. ThestructuresofvariousflavonoidsusedinthisstudyareshowninFigure1b.
shown in Figure 1b.
(a)
Figure 1. Cont.
Figure1.Cont.
2
26755
Int.J.Mol.Sci.2015,16,26754–26769
Int. J. Mol. Sci. 2015, 16, page–page
(b)
Figure 1. (a) Basic flavonoid structure showing the A and B rings and the conventional numbering of
Figure1.(a)BasicflavonoidstructureshowingtheAandBringsandtheconventionalnumberingof
ccaarrbboonn aattoommss aanndd ((bb)) ssttrruuccttuurree ooff vvaarriioouuss flflaavvoonnooiiddss uusseedd iinn tthhiiss ssttuuddyy..
2. Results and Discussion
2. ResultsandDiscussion
22..11.. CCeelllluullaarr DDNNAA BBrreeaakkaaggee bbyy FFllaavvoonnooiiddss iinn IInnttaacctt aanndd PPeerrmmeeaabbiilliizzeedd LLyymmpphhooccyytteess aass MMeeaassuurreedd bbyy
CCoommeett AAssssaayy
CCoommeett aassssaayy ((ssiinnggllee--cceellll ggeell eelleeccttrroopphhoorreessiiss)) iiss wweellll kknnoowwnn ttooooll ffoorr tthhee qquuaannttiifificcaattiioonn ooff DDNNAA
ddaammaaggee iinn ceclellululalar rsyssytestmems. s[.36[]3.6 A]. mAodimfioedd icfioemdect oamsseaty,a usssainyg, aulskianlginea lckoanlidnietiocnosn,d mitaiodnes i,t pmoasdsiebliet
ptoo sdseibtelectt othde esteinctglteh-estrsainngdl eb-srteraaknsd absr ewaeklsl aass wtheell aalskathlienea-llkaabliilne es-liatebsi leins iDteNsAin [D37N].A In[3 t7h].is Iansstahyis,
athsesa yt,wtoh esitnwgoles-sintrgalne-ds trbarnedakbsr etahkast tahraet acrloescelloys eolyppoopspeods, edsh,oswho wupu pasa sa addoouubblele ssttrraanndd bbrreeaakk..
IInn oouurr pprreevviioouuss wwoorrkk,, wwee wwereere abalbel etot odedmemonosntrsatrtaet tehtaht attheth ceomcoemt eatssaasys acyanc abne ubseeuds teod mtoeamsueraes uthree
tcheelluclealrl uDlaNrAD dNeAgraddeagtrioand aitnidonuciendd buyc epdolbyyphpeonloylps hinen houlsmiann hpuermipahnerpael rliypmheprhaolclyytmesp [h3o8c].y Ttehsis[ 3h8a]s.
Tbeheisn hcaosnfbiremenedc obnyfi rrmepeodrtbs yfrroempo rottshefrro lmabootrhaetorrliaebs oarsa tworeilels [a3s9]w wehlle[r3e9 c]owmheetr eascsoamy ewtaass suasyedw atos
uevseadluatotee vraelaucattiveer eaocxtyivgeeno xyspgeecniessp e(cRieOsS()R-mOSed)-imateeddi atDedNAD NbArebarkeaagkea gienidnudcuecde dbbyy eessttrrooggeenn--lliikkee
ccoommppoouunnddss,, ddiieetthhyyllssttiillbbeessttrrooll,, ddiiaaddzzeeiinn aanndd ggeenniisstteeiinn.. HHeerree,, wwee uusseedd tthhee ccoommeett aassssaayy ttoo tteesstt DDNNAA
bbrreeaakkaaggee bbyy 110000 µµMM ccoonncceennttrraattiioonnss ooff MMNN,, FFNN,, QQNN,, KKLL aanndd GGNN iinn iissoollaatteedd llyymmpphhooccyytteess.. AAss cclleeaarr
ffrroomm TTaabbllee1 1,,w weeo bosbesrevrevdeda par opmroimneinntenintc irnecarseeaisne thine GthNe –G,NKL–,– ,KQLN–,– Q,FNN––, aFnNd–M aNnd– mMeNdi–amteeddDiaNteAd
bDrNeaAk abgree,aaksasgheo, wasn bshyoiwncnr ebayse dinccoremaesetdta iclos.mIett istasielse.n Itth aist tsheeenh igthhaets tthleev ehligohfeDsNt Alevdeel goraf dDatNioAn
idsegcaraudsaedtiobny ism ycariucseetidn bfoyl lomwyerdicebtiyn fifsoeltlionw,eqdu ebryce tfiins,etkina,e mqupefercroetlina,n dkageamlapnfegrinol. aAndcc ogradliannggitno.
oAucrcohrydpinogth teos ios,upr ohlyyppohtehneosliss,m pooblyilpizheencohlrso mmaotbinilibzeo ucnhdrocmoaptpine rbdoiurencdt lyc,oprepseurl tdinirgecintlyc,e rlleuslualrtiDngN iAn
bcerellauklaarg eD.NWAe ,btrheearkeafgoere. ,Wtees,t ethdetrheefoereff,e tcetsotefds atmhee ecfofenccte notfr astaimones coofnflceanvtornatoiiodnss oonf pflearvmoneaobidilsiz oedn
lpyemrmpehaobciylitzeesd( Tlyamblpeh1o)c.ytWese (Tuasebdle p1e).r mWeea buisleizde dpelrymmepabhioliczyetde slybmecpahuosceytpeesr mbeecaabuisleiz pateiromneaalbloilwizastifoonr
aalldoiwresc tfoern tar ydiarnecdt ienntterrya catniodn inotfeflraacvtoionno iodfs flwavitohntohiedsc ewllitnhu tchleei ,cerells nuultcinlegi, irnessuigltniinfigc ainn tslyigninifcirceaansteldy
DinNcrAeasberdea DkaNgAe. bAresaskeaegne.i nAsth seeetanb ilne tthhies tianbdleee tdhiiss ifnoduenedd tios bfoeutnhde tcoa sbee. tThaeb lceas1e.c lTeaabrllye 1su cglegaersltys
tshuagtgtehsetsl etnhgatth thofe cloemngettht aoilf wcoams gert etaatielr winaps egrrmeaeatebri liizne dpelyrmmepahboilciyzteeds ,laysmcpohmopcayrteeds, taosi nctoamctpcaerlelsd,
ttho uisntfaucrtt hceerllssu, pthpuosr tfinugrththeer nsoutpiopnortthiantgt ethstec onmotpioonu nthdast intetsetr accotmbeptoteurnwdsit hinnteurcalceti ibneattepre rwmietha bniluizceledi
siny stae mpe.rWmeeaablsiolizoebds esryvsetdemth. atWine baolstho ionbtascetrvaendd pthearmt eina bbiloiztehd icnetlalcstt haendra tpeeorfmDeNabAilibzreeda kcaeglles wthaes
grarteea toefs tDfoNrAm ybrriecaektiang,ef owllaosw gerdeabtyesfits efotirn ,mqyureircceetitnin, ,fkoalleomwpefde rboyl afnisdetgianl,a qnugeinrcreetsinp,e cktaiveemlyp.ferol and
galangin respectively.
26756
3
Int.J.Mol.Sci.2015,16,26754–26769
Int. J. Mol. Sci. 2015, 16, page–page
TTaabbllee 11.. AA ccoommppaarriissoonn ooff DDNNAA bbrreeaakkaaggee iinndduucceedd bbyy vvaarriioouuss flflaavvoonnooiiddss iinn iinnttaacctt llyymmpphhooccyytteess aanndd
ppeerrmmeeaabbiilliizzeedd llyymmpphhooccyytteess aass aa ffuunnccttiioonn ooff ccoommeett ttaaiill lleennggtthhss.. VVaalluueess rreeppoorrtteedd aarree ˘±SSEEMM ooff tthhrreeee
iinnddeeppeennddeenntt eexxppeerriimmeennttss.. pp << 00..0011 bbyy ccoommppaarriissoonn wwiitthh ccoonnttrrooll ((uunnttrreeaatteedd cceellllss)) ffoorr eeaacchh ccoommppoouunndd..
Comet Tail Length (µM)
Flavonoids (100 µM) CometTailLength(µM)
Flavonoids(100µM) Intact Cells Permeabilized Cells
IntactCells PermeabilizedCells
Control (No Flavonoid) 3.95 ± 0.19 4.06 ± 0.20
Control(NoFlavonoid) 3.95˘0.19 4.06˘0.20
Myricetin 25.06 ± 1.25 28.90 ± 1.44
Myricetin 25.06˘1.25 28.90˘1.44
Fisetin 20.45 ± 1.02 25.03 ± 1.25
Fisetin 20.45˘1.02 25.03˘1.25
Quercetin 17.74 ± 0.88 23.50 ± 1.17
Quercetin 17.74˘0.88 23.50˘1.17
Kaempferol 16.03 ± 0.80 20.66 ± 1.03
Kaempferol 16.03˘0.80 20.66˘1.03
Galangin Galangin 14.8154 ±.8 05.7˘4 0.74 19.44˘109..9474 ± 0.97
2.2. Formation of Complexes of Flavonoids
2.2. FormationofComplexesofFlavonoids
Figure 2 shows the effect of addition of calf thymus DNA to MN, FN, QN, KL and GN at an
Figure 2 shows the effect of addition of calf thymus DNA to MN, FN, QN, KL and GN at
equimolar base pair ratio of DNA vs. flavonoids (1:1). The mixture was excited at specific
an equimolar base pair ratio of DNA vs. flavonoids (1:1). The mixture was excited at specific
wavelengths provided in legends. It is seen that there is an enhancement of the emission spectra of
wavelengthsprovidedinlegends. Itisseenthatthereisanenhancementoftheemissionspectraof
aallll tthhee fifivvee flflaavvoonnooiiddss iinn tthhee pprreesseennccee ooff DDNNAA.. HHoowweevveerr,,w weed diiddn noottn noottiicceea as shhififtti ninλ λmax ooff eemmiissssiioonn..
max
This suggests a simple mode of binding of flavonoids to DNA.
ThissuggestsasimplemodeofbindingofflavonoidstoDNA.
FFiigguurree 22.. EEffffeecctt ooff iinnccrreeaassiinngg nnaattiivvee DDNNAA bbaassee ppaaiirr mmoollaarr rraattiioo oonn tthhee fflluuoorreesscceennccee eemmiissssiioonn ssppeeccttrraa
ooff FFllaavvoonnooiiddss.. FFllaavvoonnooiiddss wweerree eexxcciitteedd aatt ddiiffffeerreenntt wwaavveelleennggtthhss ((MMNN == 338800 nnmm,, FFNN == 336655 nnmm,,
QQNN == 337700 nnmm,, KKLL == 336655 nnmm,, GGNN == 336655 nnmm)) iinn tthhee pprreesseennccee ooff iinnccrreeaassiinngg nnaattiivvee DDNNAA bbaassee ppaaiirr mmoollaarr
((11::11)) aanndd tthhee eemmiissssiioonn ssppeeccttrraa wweerree rreeccoorrddeedd..
22..33.. EEffffeecctt oof fRReaeactcitvive eOOxyxgyegne nScSacvaevnegnegrse rosno tnhet hFelaFvloanvooindso-iIdnsd-Iuncdedu cDedNDA NBrAeaBkaregaek iang Peeirnmeabilized Lymphocytes
PermeabilizedLymphocytes
In order to confirm that the flavonoid-induced lymphocyte DNA breakage results from ROS
geneIrnatioornd,e wr eto hcaovne fisrtmuditehda tththe eefflfeacvto onfo siodm-ined sucacevdenlgyemrsp hofo cRyOteS DonN cAombreeta tkaailg leenrgesthu lftosrfmroamtioRn ObSy
gpelannetr aptoiolynp,hweenohlasv [e5]s.t uTdabieled 2t hseumeffmecatriozfesso tmhee osbcsaevrevnagtieornsso ffrRomOS aonn excpomereimtteanilt lwenhgetrhe fwoerm teasttieodn tbhye
effects of catalase, SOD and thiourea on flavonoid-induced DNA degradation in permeabilized
lymphocytes. As expected, all the flavonoids induced significant DNA damage, and resulted in
26757
4
Int.J.Mol.Sci.2015,16,26754–26769
plant polyphenols [5]. Table 2 summarizes the observations from an experiment where we tested
the effects of catalase, SOD and thiourea on flavonoid-induced DNA degradation in permeabilized
lymphocytes. As expected, all the flavonoids induced significant DNA damage, and resulted in
increased tail lengths of comets, compared to control cells (p < 0.01). The three scavengers tested
(catalase, SOD and thiourea) were found to particularly inhibit flavonoid-induced DNA breakage
very effectively, as suggested by reduced comet tail length. Catalase and SOD are scavengers of
H O andsuperoxide,respectively,whilethioureascavengeshydroxylradicals.Fromtheexperiment
2 2
presentedhere,wecansafelyinferthatROSisprimarilyinvolvedinthecellulardamagecausedby
flavonoidsandthatthemainROSinvolvedintheprocessarethesuperoxideanionsandthehydroxyl
radicals. ItisworthmentioningthatsuperoxideanionspontaneouslyleadstotheformationofH O .
2 2
H O , in turn, leads to the generation of hydroxyl radicals through a process that is dependent
2 2
on the oxidation of reduced transition metals [40]. It is also well recognized that the hydroxyl
radicals interact with DNA in such proximity that a complete scavenging of hydroxyl radicals is
notachievable[41].
Table2.Effectofscavengersofreactiveoxygenspeciesonflavonoid-inducedcellularDNAbreakage
inpermeabilizedcells.*p<0.05,comparedwithcontrol(flavonoidonly)cells.Datarepresent˘SEM
ofthreeindependentexperiments.
IntactCells PermeabilizedCells
Treatment
CometTailLength% Inhibition(µM) CometTailLength% Inhibition(µM)
Control 3.156˘0.17 - 3.25˘0.16 -
Myricetin(100µM) 25.03˘1.25 - 31.56˘1.57 -
+SOD(100µg/mL) 11.26˘0.56* 55.0 13.28˘0.76* 57.9
+Catalase(100µg/mL) 12.46˘0.62* 50.2 15.05˘0.80* 52.3
+Thiourea(1mM) 14.08˘0.70* 43.7 16.86˘0.84* 46.5
Fisetin(100µM) 22.96˘1.14 - 27.04˘1.35 -
+SOD(100µg/mL) 12.20˘0.61* 46.8 14.24˘0.71* 47.3
+Catalase(100µg/mL) 12.76˘0.63* 44.4 14.64˘0.73* 45.8
+Thiourea(1mM) 13.04˘0.65* 43.2 15.05˘0.75* 44.3
Quercetin(100µM) 20.32˘1.01 - 24.54˘1.22 -
+SOD(100µg/mL) 10.46˘0.52* 48.5 11.23˘0.56* 54.2
+Catalase(100µg/mL) 11.06˘0.55* 45.5 13.42˘0.67* 45.3
+Thiourea(1mM) 14.80˘0.74* 27.1 14.95˘0.74* 39.07
Kaempferol(100µM) 17.63˘0.88 - 21.54˘1.07 -
+SOD(100µg/mL) 9.50˘0.47* 46.1 10.36˘0.51* 51.9
+Catalase(100µg/mL) 10.44˘0.52* 40.7 10.45˘0.52* 51.4
+Thiourea(1mM) 11.05˘0.55* 37.3 12.45˘0.62* 42.2
Galangin(100µM) 14.40˘0.72 - 18.44˘0.92 -
+SOD(100µg/mL) 8.55˘0.32* 40.6 9.65˘0.63* 47.6
+Catalase(100µg/mL) 9.40˘0.37* 34.7 11.32˘0.59* 38.6
+Thiourea(1mM) 10.15˘0.50* 29.5 10.55˘0.53* 42.7
2.4. EffectofSpecificChelatorsofMetalsonFlavonoid-InducedDNABreakageinIntactand
PermeabilizedLymphocytes
Nextweusedthespecificchelatorsofseveralmetals(suchasthechelatorsthatselectivelybind
to copper, iron and zinc) and evaluated their effect, if any, on flavonoid-induced DNA degradation
in whole as well as permeabilized cells. We observed a clear inhibition of DNA degradation in
whole cells when we used neocuproine. Neocuproine is a Cu(I) chelator that is cell membrane
permeable (Table 3). However, we did not see any inhibition when we used bathocuproine.
Bathocuproine is a water soluble analog of neocuproine, but is membrane-impermeable. Similarly,
no inhibition was observed when we used desferrioxaminemesylate (Fe(II)-specific chelator) and
histidine (a zinc-specific chelator). In permeabilized lymphocytes, it was observed that both the
Cu(I) chelators, neocuproine and bathocuproine, could inhibit DNA breakage because membrane
permeability was no longer a determining factor. Iron and zinc chelators were still found to be
ineffectiveinaffordingprotection.
26758
Int. J. Mol. Sci. 2015, 16, page–page
Table 3. Effect of chelators of metals on flavonoids-induced cellular DNA degradation in lymphocytes.
Values shown in this table represent flavonoid-induced cellular DNA breakage in whole and
permeabilized lymphocytes measured as a percentage of the control (DNA breakage in the absence
of chelators). Data represent ±SEM of three independent experiments. * p < 0.05, compared to
Int.J.Munolt.reSacit.e2d0 1w5,h1o6,le2 6l7y5m4–p2h67o6c9ytes (comet tail length = 3.43 ± 0.13). ** p < 0.05, compared to untreated
permeabilized lymphocytes (comet tail length = 3.85 ± 0.17).
Table 3. Effect of chelators of metaWlshoonle Lflyavmopnhooidcsy-tiensduced cePlleurlmareaDbNiliAzedd eLgyrmadpahtoiocnyteins
lymphocytes.DVoaselu es shown in thisCtaobmleetr eTpariel sent oflfa vCoonnotirdo-linducedCocmelleutl TaraiDl NA broefa Ckaognetrionl
Length % (µM) Length % (µM)
wholeandpermeabilizedlymphocytesmeasuredasapercentageofthecontrol(DNAbreakageinthe
absencMeoyfriccheetilant o(2r0s)0. µDMat)a represent3˘1.S2E4M ± 1o.f56th *r eeindepe-n dentexpe3r7im.9e0n ±t s1..8*9p *<* 0.05,comp- ared
+Neocuproine (200 µM) 21.06 ± 1.12 32.5 23.04 ± 1.15 39.2
tountreatedwholelymphocytes(comettaillength=3.43˘0.13). **p<0.05,comparedtountreated
+Bathocuproine (200 µM) 29.86 ± 1.50 4.41 22.50 ± 1.12 40.6
permeabilizedlymphocytes(comettaillength=3.85˘0.17).
+Histidine (200 µM) 30.63 ± 1.55 1.95 37.73 ± 1.88 0.44
+Desferioxaminemesylate (200 µM) 30.04 ± 1.53 3.84 37.15 ± 1.85 1.97
WholeLymphocytes PermeabilizedLymphocytes
Dose
Fisetin (200 µM) CometTai2l9L.e8n0g t±h 1%.49 * ofControl-( µM) Com36e.t0T4a i±l L1e.n8g0t h**% ofCon-t rol(µM)
M+yNrieceoticnu(p20r0oµinMe) (200 µM) 31.24˘210..5367* ± 0.91 -31.6 327.39.05˘4 ±1. 819.1**7 34.6-8
+N+eBoacuthproocinuep(2r0o0inµeM ()200 µM) 21.06˘281..8124 ± 1.39 32.35.22 2232..0343˘ ±1 1.1.511 383.09.42
+Bathocuproine(200µM) 29.86˘1.50 4.41 22.50˘1.12 40.6
+Hi+stHidiinseti(d20i0nµe M(2)00 µM) 30.63˘291..4550 ± 1.47 1.915.34 3376..7030˘ ±1 1.8.880 0.01.414
+D+Desfeesrifoexraimoxinaemmeisnyelamtee(2s0y0laµtMe )(200 µM3)0 .04˘291..1531 ± 1.45 3.824.31 3375..1358˘ ±1 1.8.576 1.18.937
Fisetin(200µM) 29.80˘1.49* - 36.04˘1.80** -
+NeocQupureoirncee(t2i0n0 µ(2M0)0 µM) 20.372˘6.03.931 ± 1.40 * 31.6- 332.33.544 ±˘ 11..6176 ** 3-4 .68
+Bathocuproine(200µM) 28.84˘1.39 3.22 22.33˘1.11 38.04
+Neocuproine (200 µM) 18.54 ± 0.86 29.5 21.96 ± 1.09 34.13
+Histidine(200µM) 29.40˘1.47 1.34 36.00˘1.80 0.11
+Desferi+oBxaamthinoecmuepsyrloatien(e20 (02µ0M0 )µM) 29.11˘251..6459 ± 1.31 2.321.43 2351..3483˘ ±1 1.7.607 351.7.823
Quercetin(200µM) 26.33˘1.40* - 33.34˘1.66** -
+Histidine (200 µM) 26.04 ± 1.35 1.10 33.30 ± 1.66 0.11
+Neocuproine(200µM) 18.54˘0.86 29.5 21.96˘1.09 34.13
+D+eBsaftehroicouxparominien(e2m00eµsMy)late (200 µM2)5 .69˘261..0310 ± 1.34 2.413.25 3212..4839˘ ±1 1.0.764 13.35.47 2
+Histidine(200µM) 26.04˘1.35 1.10 33.30˘1.66 0.11
Kaempferol (200 µM) 21.76 ± 1.18 * - 30.23 ± 1.51 ** -
+Desferioxaminemesylate(200µM) 26.00˘1.34 1.25 32.89˘1.64 1.34
Ka+eNmpefoecroulp(2r0o0inµeM ()200 µM) 21.76˘161..1583* ± 0.72 -24.03 320.02.34˘4 ±1. 511.0**2 32.3-8
+Neocuproine(200µM) 16.53˘0.72 24.03 20.44˘1.02 32.38
+Bathocuproine (200 µM) 21.28 ± 1.15 2.20 19.70 ± 0.98 34.83
+Bathocuproine(200µM) 21.28˘1.15 2.20 19.70˘0.98 34.83
+Hi+stHidiinseti(d20i0nµe M(2)00 µM) 21.68˘211..6178 ± 1.17 0.306.36 3300..1199˘ ±1 1.5.050 0.01.133
+Desferioxaminemesylate(200µM) 21.52˘1.17 1.10 30.07˘1.50 0.52
+Desferioxaminemesylate (200 µM) 21.52 ± 1.17 1.10 30.07 ± 1.50 0.52
22..55.. SSttooiicchhiioommeettrryy ooff CCuu((IIII)) RReedduuccttiioonn bbyy FFllaavvoonnooiiddss
RReeddooxx rreeccyycclliinngg ooff CCuu((IIII))//CCuu((II)) iiss kknnoowwnn ttoo bbee aann iimmppoorrttaanntt ffaaccttoorr iinn tthhee iinndduuccttiioonn ooff
ccooppppeerr--mmeeddiiaatteedd DDNNAA bbrreeaakkaaggee [[2222,,3300]].. TThheerreeffoorree, ,wwee nneexxtt aasssseesssseedd tthhee rreellaattiivvee eeffffiicciieennccyy ooff
rreedduuccttiioonn ooff CCuu((IIII)) bbyy MMNN,, FFNN,, QQNN,, KKLL aanndd GGNN ththrorouugghh stsotoicichhioiommeetrtircic stsutuddieise.s. JJoobbpplloottss ooff
aabbssoorrbbaannccee vveerrssuuss ((CCuu((IIII))))//((ffllaavvoonnooiiddss)) ((FFiigguurree 33)) iinnddiiccaattee tthhaatt aallll ffllaavvoonnooiiddss wweerree aabbllee ttoo rreedduuccee
CCuu((IIII)) ttoo CCuu((II)).. HHoowweevveerr,, iitt iiss aallssoo eevviiddeenntt tthhaatt mmyyrriicceettiinn wwaass tthhee mmoosstt eeffffiicciieenntt rreedduucceerr ooff CCuu((IIII))
aammoonngg aallll tthhee tteesstteedd flflaavvoonnooiiddss wwhheerreeaass ggaallaannggiinn wwaass tthhee lleeaasstt eefffificciieenntt..
FFiigguurree 33.. SSttooiicchhiioommeettrryy ooff FFllaavvoonnooiidd––CCuu((IIII)) iinntteerraaccttiioonnss.. TThhee ccoonncceennttrraattiioonn ooff mmyyrriicceettiinn,, ffiisseettiinn,,
qquueerrcceettiinn,, kkaaeemmppffeerrooll aanndd ggaallaannggiinn wwaass 1100 µµMM iinn tthhee pprreesseennccee ooff 00..33 mmMM bbaatthhooccuupprrooiinnee ((1100 mmMM
TTrriiss––HHCCll)).. AAllll tthhee ppooiinnttss aarree rreepprreesseennttaattiivvee ooff ttrriipplliiccaattee ssaammpplleess aanndd mmeeaann vvaalluueess aarree ppllootttteedd..
2.6. IntracellularGenerationofH O /ROSbyFlavonoids
2 2
6
It has been reported that polyphenols can auto-oxidize under invitro conditions resulting in
generation of H O radicals and quinone, which can potentially enter cellular nuclei, thus causing
2 2
damage to many molecules [42]. This interaction can further generate extraneous ROS accounting
forevenfurtherdamagetotheintegrityofDNA.Inanattempttoexcludethispossibility,wecarried
26759
IInntt.. JJ.. MMooll.. SSccii.. 22001155,, 1166,, ppaaggee––ppaaggee
22..66.. IInnttrraacceelllluullaarr GGeenneerraattiioonn ooff HH22OO22//RROOSS bbyy FFllaavvoonnooiiddss
IItt hhaass bbeeeenn rreeppoorrtteedd tthhaatt ppoollyypphheennoollss ccaann aauuttoo--ooxxiiddiizzee uunnddeerr iinn vviittrroo ccoonnddiittiioonnss rreessuullttiinngg iinn
ggeenneerraattiioonn ooff HH22OO22 rraaddiiccaallss aanndd qquuiinnoonnee,, wwhhiicchh ccaann ppootteennttiiaallllyy eenntteerr cceelllluullaarr nnuucclleeii,, tthhuuss ccaauussiinngg
ddaammInaat.ggJee.M ttoool. mSmciaa.2nn0yy15 ,mm16oo,2lle6e7cc5uu4–ll2ee6ss7 6[[94422]].. TThhiiss iinntteerraaccttiioonn ccaann ffuurrtthheerr ggeenneerraattee eexxttrraanneeoouuss RROOSS aaccccoouunnttiinngg
ffoorr eevveenn ffuurrtthheerr ddaammaaggee ttoo tthhee iinntteeggrriittyy ooff DDNNAA.. IInn aann aatttteemmpptt ttoo eexxcclluuddee tthhiiss ppoossssiibbiilliittyy,, wwee ccaarrrriieedd
oouutt ooouuutrro ueexxrppeeexrrpiiemmrieemnnettn fftoofrro rtthhtheee gggeeennneeerrraaatttiiiooonnn ooofff HHH2O2OO22 bbbyyyfl ffallvaaovvnooonnidooisiddissn iitnnh etthhineec uiinnbccauutibobnaattmiiooennd immumeedd.iiuuWmme..a WWlsoee aallssoo
2 2
uusseeddu s tteaadnnntnaiinccn aaiccciiaddc iiidnn ioonuuorru eerxxeppxeeprreiirmmimeenennttaatall lssseeettt---uuuppp,,, aaa pppooosssiiitttiiivvveee cccooonnntrttorrolollf offroorrH HH2O22OO2 2p2 rpporrdoouddcuuticcottniioo[nn4 3 [[]44.33A]].. s AAsses essneeeenn iinn
FFiigguuinrreeF i44g,,u ttraaenn4nn,iitcca naancciiicdda ceeiffdffeeeccfttfieivvceteillvyye lggyeegnneeenrreaarttaeetses sHHH222OOO222.. .OOOuuurrr ttteeesssttt cccooommmpppouoonuudnnsddwss ewwreeercrelee accrllleeyaanrrlloyyt annsooett f faaessc teeivffffeeeccttiivvee
pprrooddpruuoccdeeurrscse roosffo fHHH222OOO222 aaasss tattnaannninnciiaccc iadaccbiidudt wbbuuettc owwuleed scctoiolluuolldbds essrttviilelll Hoo2bbOss2eeprrvvroeed uHHct22iOOon22 bppyrrflooaddvuuoccnttoiiooidnns mbbyyy riffclleaatvvinoo,nnooiiddss
mmyyrrfiiicsceeetttiiinnn,,a ffniidsseeqttiiunne raacnneddti n qq.uuHeerr2ccOeet2tiinnp..r oHHd22uOOct22i oppnrroobddyuukccattiieoomnnp bbfeyyr okklaaaeenmmdppgffaeelrraoonllg aainnnddw ggasaallmaanneggasiinnu r wwedaassto mmbeeeaaassluumrreoedsdt ttoo bbee
aallmmnooessgtt linngeeibggllleiig,giiwbbhlleee,,n wwcohhmeennp accrooemdmptpoaartrheeedd otttooh ettrhheete sootttehhdeeflrr attveeosstnteeoddid ffsllaaavvnoodnntoohiieddtssa naannniddc atthchieed .ttaaTnnhnnuiiscc, aathccieiddse.. TTrehhsuuulsst,,s tthheessee
rreessuuslluttsps pssuourpptpproeosrrutt lrrtesessduuellsttcssr ddibeeessdccrriiinbbeeTdadb iilnne T1Taawbbhlleee r11e wwthhheeeorrreed ttehhreeo oofrrcddeleelrur looaffr ccDeeNlllluuAllaabrrr eDDaNNkaAAge bbbrryeeaaflkkaaavggoeen bobiyyd sffllaawvvaoosnnooiiddss
MN>FN>QN>KL>GN.
wwaass MMNN >> FFNN >> QQNN >> KKLL >> GGNN..
Wealsoevaluatedthelengthofcomettailasafunctionofincreasingflavonoidsconcentrations.
WWee aallssoo eevvaalluuaatteedd tthhee lleennggtthh ooff ccoommeett ttaaiill aass aa ffuunnccttiioonn ooff iinnccrreeaassiinngg ffllaavvoonnooiiddss ccoonncceennttrraattiioonnss..
Again tannic acid was used as internal control. The results shown in Figure 5 clearly show that
AAggaaiinn ttaannnniicc aacciidd wwaass uusseedd aass iinntteerrnnaall ccoonnttrrooll.. TThhee rreessuullttss sshhoowwnn iinn FFiigguurree 55 cclleeaarrllyy sshhooww tthhaatt
exposure to flavonoids resulted in the formation of comet tails, which were found to positively
eexxppocoossruurrereela ttteoo wfflliaathvvoothnneooiiidndcssr erraeesssiuunlgltteecddo n iicnne nttthhraeet iffooonrrmmofaattthiiooennfl aoovffo cncooommidsee.tt Tttaaaiinllsns,,i cwwahhciiidcc,hhh wwoweerereev effroo,uuwnnadds nttooot ppvooerssyiittiivveellyy
ccoorrrreeefllfaaetcteeti vwweiititnhh ctthahuees iiinnngccrrDeeaaNssiiAnnggd accmoonnaccgeeenn, ttarrsaattviiooisnnu aooliffz etthhdeeb ffyllaaivvnoocrnneooaiisddinssg.. TTcaoanmnnneiitcc taaaiccliiddle,,n hhgoothww,eepvvaeerrtri,,c uwwlaaarssl ynnooattt vveerryy
eeffffeetcchttieivvhee i giinnh eccsaatuudssoiinnsegg tDDesNNteAAd. ddTaahmmisaaggshee,o, waasss vvthiissauutaatllhiizezreeedd i sbbyyn oiinnccclrreeeaaarssciinonrggr ecclaootmmioeentt bttaeatiiwll lleeeennnggHtthh,,O ppaarrpttriioccduuullaacrrtilloyyn aatt tthhee
2 2
hhiigghhaeenssdtt cddeoollssueela rtteeDssttNeeddA.. dTTahhmiissa gssehhoobwwecssa uttshheaattth ttehhmeerroees tiisse fnnfeooc tcicvlleeeaagrre cncooerrrarrteeollarattoiioofnnH 2bbOeett2wwdeeiedennn oHHt22cOOa22u spperroothddeuumccttoiioosntn aanndd
cceelllluuDllaaNrr A DDdNNaAAm dadgaaemm.aaggee bbeeccaauussee tthhee mmoosstt eeffffeeccttiivvee ggeenneerraattoorr ooff HH22OO22 ddiidd nnoott ccaauussee tthhee mmoosstt DDNNAA ddaammaaggee..
FFiigguuFrirgeeu 44re.. AA4. ccAoommcoppmaaprriiassrooisnno nooffo ftthhtheee rrraaattteee ooofff HHH222OOO222 fffooorrrmmmaaatittoiioonnnb ybbyyta ttnaannnicnniiaccc iaadcc,iimdd,,y mmricyyerrtiiincce,ettfiiinsne,, t iffniiss,eeqttuiinne,,r cqqeuutienerr,cceettiinn,,
kkaaeemkmappemffeeprroofellr aaonnladdn ggdaagllaaalnnaggniignnin iinnin tththheee iiinnncccuuubbbaaatttiiiooonnn m mmeeedddiuiiuummma saadss eddteeerttmeerrimmneiidnneebddy FbbOyy XFFOOasXXsa aay.ssssaayy..
FFiigguuFrirgeeu 5r5e.. 5AA. ccAoommcoppmaarrpiiassrooinsno nooffo fDDDNNNAAA bbbrrreeeaaakkkaaagggeee iiinnnddduuuccceeedddb ybbyyt a tntaannnicnniiaccc iaadcc,iiddm,,y mrmicyyerrtiiincce,ettfiiinnse,, tiffniiss,eeqttiiunne,,r cqqeuutienerr,cceettiinn,,
kkaaeemkmappemffeeprroofellr oaalnnaddn dgggaaallalaannngggiiinnn iiinnnh uhhmuummanaapnne rppipeehrriiepprhahleelrryaamll pllyhymomcpypthheoosccayysttaeefssu naacsst iaao nffouufnncccottmiiooennt tooaiffl lcceoonmmgteehtts .ttVaaaiilll ulleeesnnggtthhss..
VVaalluureeepsso rrreeteppdooarrtrteeedd˘ aaSrrEeeM ±±SSoEfEtMMhr eooeff ittnhhdrreeepeee iinnndddeeenppteeennxpddeeernnimtt eeexxnpptsee.rriimmeennttss..
2676770
Int.J.Mol.Sci.2015,16,26754–26769
2I.n7t.. JT. Mheorl.m Socid. y20n1a5m, 1i6c,s poafgFe–lapvagoen oid–ctDNABinding-IsoThermalCalorimetricStudies(ITC)
2.7. TThheerrmmooddynyanmamicsic ofp Falaravmoneotiedr–sctoDfNflAa vBoinndoiindg-cIsoom Tphleerxmeasl CwailtohrimcteDtrNicA Stuwdeierse (IaTsCse)s sed by fitting
the integrated heats as per the one binding site model shown in Table 4. Enthalpy changes for
Thermodynamic parameters of flavonoid complexes with ctDNA were assessed by fitting the
binding of five flavonoids to ctDNA were negative, indicating an exothermic binding process
winitthegrealetecdtr ohsetaattsic asi npteerr athctei oonnse. binFduirnthg esri,tet mheodneelg sahtoivwene innt rToapbyle t4e.r Emnst,haTlp∆yS ˝ch=ang´e2s. 0fo8r kbJi¨nmdionlg´ 1o,f
´fi8v.e3 4flkaJv¨omnooli´d1s, t´o 1ct4D.6N¨kAJ¨ wmeorle´ 1n,e´ga1t7iv.2e8, iknJd¨micaotli´n1g aannd ex´o1t9h.e0r7mkiJc¨ bminodl´in1gf oprroGcNes,sK wLi,thQ eNle,cFtrNosatantdic
interactions. Further, the negative entropy terms, T∆S° = −2.08 kJ·mol−1, −8.34 kJ·mol−1, −14.6·kJ·mol−1,
MN, respectively, indicate the binding of these flavonoids is predominately enthalpy driven. It can
−17.28 kJ·mol−1 and −19.07·kJ·mol−1 for GN, KL, QN, FN and MN, respectively, indicate the binding of
also be seen that for all flavonoids tested, both enthalpy as well as entropy have negative values,
these flavonoids is predominately enthalpy driven. It can also be seen that for all flavonoids tested,
which suggests an essential role of hydrogen bonding and van der Waals force in the binding of
flbaovtohn eonidthsatlpoyc taDs NwAel.l aDsu ernintrgopthye hianvteer naecgtiaotnivpe rvoacleusess,, twhehihcihg hsuerggneesgtsa taivne esvsaelnuteisal orfol∆e Go˝f hsyudgrgoegstesn
bonding and van der Waals force in the binding of flavonoids to ctDNA. During the interaction
that the formation of flavonoid–ctDNA complexes will be much more spontaneous in nature as
cpormocpeasrse,d thtoe thhieghceorm pnleegxaetsivwe hvicahlueesx hoibf it∆lGo°w esrugngeegsattsi vtehavta ltuhees foofrm∆Gat˝io.n Coofn sfildaveroinnogidth–cetD∆NG˝A
vcaolmuepslefoxresd iwffeilrle bnet flmauvcohn omidosr,ei tscpaonntbaenceoonucsl uind endattuhraet masy croicmetpinarheads ttoh ethheig choemstpnleexgeasti vweh∆icGh˝ evxahliubeit
lower negative values of ∆G°. Considering the ∆G° values for different flavonoids, it can be
(´30.01kJ¨mol´1)andthereforewillformstrongerinteractionswithctDNAascomparedtotherest
concluded that myricetin has the highest negative ∆G° value (−30.01 kJ·mol−1) and therefore will form
ofthetestedflavonoids.
stronger interactions with ctDNA as compared to the rest of the tested flavonoids.
Table 4. The binding constant/stoichiometry and thermodynamic parameters for the binding of
mTyarbiclee ti4n. ,Tfihsee tibni,nqduinegrc ectoinns,tkaanet/mstpofiecrhoilomanedtryg aalanndg itnhetormcotDdNynAa,maisc dpeatrearmmienteerds wfoitrh thITeC baintd2i5ng˝ Co.f
“mn”y,ripcoestisnib, lfeisnetuinm, bqeureorfcebtiinnd, kinagemsiptefse;roKl aa,nbdin gdainlagngcoinn stota ncttD; ∆NHA,, ∆asS daentder∆mGin,esdta wnditahr dITcCh aantg 2e5s °oCf.
e“nnth”,a lppoys,seinbtlero npuymanbderG oifb bb’isnfdrienege nsietregsy; Kfoar, pbienrdminogle coofnrsetsapnet;c t∆ivHe, fl∆aSv oannodi d∆bGo, usntadntdoacrtdD cNhAan.ges of
enthalpy, entropy and Gibb’s free energy for per mole of respective flavonoid bound to ctDNA.
FlavFolnaoviodnoidKa(KMa(´ M1)−1) nn ∆∆HH(k(kJJ//mmooll)) ∆S∆(SJ/(mJ/molo/lk/k)) ∆G∆ (kGJ(/kmJ/oml)o l)
Myricetin 1.9ˆ102 74.62 ´49.21 ´64.43 ´30.01
Myricetin 1.9 × 102 74.62 −49.21 −64.43 −30.01
Fisetin 0.9ˆ102 66.50 ´43.01 ´58.18 ´25.67
Fisetin 0.9 × 102 66.50 −43.01 −58.18 −25.67
Quercetin 0.8ˆ102 63.32 ´39.81 ´49.76 ´24.98
KaemQpufeerrocletin 0.60ˆ.81 ×0 2102 5613..4332 −´3931.8.716 −4´92.786.8 9 −24´.9283 .15
GaKlaanegminpferol 0.30ˆ.61 ×0 2102 4541..6473 −´3122.7.265 −2´8.78.91 1 −23´.1250 .13
Galangin 0.3 × 102 44.67 −22.25 −7.11 −20.13
Figure 6. Molecular docked structure of myricetin with B-DNA. (A) Surface view interaction of
Figure 6. Molecular docked structure of myricetin with B-DNA. (A) Surface view interaction of
myricetin with B-DNA; (B) Hydrogen bonding interactions (6) and distance in Å of myricetin with
myricetinwithB-DNA;(B)Hydrogenbondinginteractions(6)anddistanceinÅofmyricetinwith
dodecamer duplex of sequence (CGCGAATTCGCG)2 (PDB ID: 1BNA).
dodecamerduplexofsequence(CGCGAATTCGCG) (PDBID:1BNA).
2
2.8. Molecular Docking Studies
2.8. MolecularDockingStudies
As evident from the results (Figures 6–10 and Table 5), myricetin (Figure 6) forms six hydrogen
Asevidentfromtheresults(Figures6–10andTable5),myricetin(Figure6)formssixhydrogen
bonds with nitrogenous bases of B-DNA (G-12, G-4 and G-2) resulting in more negative Hex binding
bondswithnitrogenousbasesofB-DNA(G-12,G-4andG-2)resultinginmorenegativeHexbinding
energy (−6.13 kcal/mol). On the other hand, fisetin (Figure 7) forms only four hydrogen bonds with
energy(´6.13kcal/mol). Ontheotherhand,fisetin(Figure7)formsonlyfourhydrogenbondswith
B-DNA (A-5, G-4 and C-11) as compared to myricetin. This lesser hydrogen bonding resulted in
B-DNA(A-5,G-4andC-11)ascomparedtomyricetin.Thislesserhydrogenbondingresultedinlower
lower negative binding energy (−5.56 kcal/mol). Quercetin (Figure 8) possesses five hydroxyl
groups, less than myricetin and greater than fisetin, but it shows the formation of only three
hydrogen bonds with nitrogenous bases of B-DNA (G-2, G-4 and G-10). The reason for this may be
26761
that a larger portion of the quercetin molecule lies away from the minor groove, as preventing the
8
Int.J.Mol.Sci.2015,16,26754–26769
negativebindingenergy(´5.56kcal/mol). Quercetin(Figure8)possessesfivehydroxylgroups,less
than myricetin and greater than fisetin, but it shows the formation of only three hydrogen bonds
with nitrogenous bases of B-DNA (G-2, G-4 and G-10). The reason for this may be that a larger
Int. J. Mol. Sci. 2015, 16, page–page
portionofthequercetinmoleculeliesawayfromtheminorgroove,aspreventingtheproximityofthe
majorityofitshydroxylgroupstoDNAnitrogenousbasesasrevealedbydockingstudies(Figure8B)
Int.p J.r Moxoil.m Sciit.y 2 0o1f5 ,t 1h6e, pmagaej–opraigtey of its hydroxyl groups to DNA nitrogenous bases as revealed by docking
hence,relasttuivdeielys (lFeisgsubrein 8dBi)n hgeenncee,r greylaitsivoeblyt aliensse db.inKdainegm epnfeergroy li(sF oigbutarinee9d). aKnademgaplfaernogl i(nFi(gFuirgeu 9r)e a1n0d) form
only twporogaxanilmdaniotgyinn oe (fF htihgyeud rmreo a1gj0oe)r inftoyrb moof noitdns l(hys y)tdwwrooi xathynld ng orintorueo phgsye dtnoro oDguNesnAb b anosinterdso(gs()eA wn-oi5tuhsa nbniatdrsoeCsg ea-n9s o)rueasvn ebdaalse(edGs b(-A1y0 -d5)o arcnekdsinp Cge- c9t) ively,
resultinsgtuiandnidee sv( Ge(F-n1i0gl)uo rrwees pe8erBctb)i vihneeldyn,i crnee,gs ureletnlianetgir vigney leyv( eKlenLs lso =wbie´nr d5bii.nn2gd4 inekgnc eearnlge/yrmg yiso (Klo,LbG t=a Ni−n5e.=2d4.´ kKc5aa.le0/mm1opklf,c eGarNol/l =m( F−5iog.0lu)1r akesc a9cl)/o mamnoldp) aasr edto
galcaonmgpina r(Fedig utor em 10y)r ifcoertmin .o Tnlhye rtwefoo raen, dfo ornmea htiyodnr oogf eonn blyo nodn(es )h wyidthro ngietnro bgoennodu ws bitahs ensi t(rAo-g5e nanodu sC b-9a)s es
myricetin. Therefore,formationofonlyonehydrogenbondwithnitrogenousbases(A-6andA-7)of
and(A (G-6- 1a0n) dre sApe-7ct)i voefl yB, r-eDsuNltAin, gc ionn efviremn slo wtheer bleinasdti nsgt aebnielritgyy (oKf Lg =a −la5n.2g4i nkc awl/imtho lB, G-DNN =A −5 a.0m1 kocnagl/smt oall)l afsi ve
B-DNA,confirmstheleaststabilityofgalanginwithB-DNAamongstallfiveflavonoids.Again,these
comflapvaornedo idtos . mAygraiicne,t itnh.e sTeh reerseufoltrse ,a rfoe rimn actoionnfo romf iotnyl yw iothn et hhey rderloagtievne bceolnludl awr iDthN nAit rborgeaeknaogues cbaapsaecsi ty
resultsa(rAeb-6iyn athcnoed n fiAfvoe-7r f)ml aovifto ynBwo-DidiNtsh Auts,h ecdeo.nr efilramtisv ethcee lleluaslta rstDabNiliAty borfe agaklaagngeicna wpaitchi tBy-DbyNtAh eamfivonegflsta valol nfoivied sused.
flavonoids. Again, these results are in conformity with the relative cellular DNA breakage capacity
by the five flavonoids used.
Figure 7. Molecular docked structure of fisetin with B-DNA. (A) Surface view interaction of fisetin
Figure7. MoleculardockedstructureoffisetinwithB-DNA.(A)Surfacevie winteractionoffisetin
with B-DNA; (B) Hydrogen bonding interactions (4) and distance in Å of fisetin with dodecamer
with B-DFiNgduuArpe; l7e(.xB Mo)fo Hsleeyqcuudleranorc gdee o(nCckGbeCdo GnstAdruiAncTtguTrCien GotCef rGfais)ce2 tt(iiPonD nwBsi tI(hD4 :)B 1-aBDnNNdAA)d.. (iAst)a Snucrefaicne vÅiewo finfitesreatcitnionw oitfh fisdeotind ecamer
duplexowfitshe qBu-DeNncAe; ((BC)G HCyGdrAogAeTnT bConGdCinGg )int(ePrDacBtioInDs :(14B) NanAd )d.istance in Å of fisetin with dodecamer
2
duplex of sequence (CGCGAATTCGCG)2 (PDB ID: 1BNA).
Figure 8. Molecularly docked structure of quercetin with B-DNA. (A) Surface view interaction of
quercetin with B-DNA; (B) Line pose of quercetin showing the majority of its structure away from
Figtuhree m 8i.n Moro glercouolvaer lnyu dcolecokteidde sst; r(uCc)t uHrye dorfo gqeune rbcoetnidni nwgi tihn tBer-DacNtioAn. s( A(3)) Saundrf adcies tavniecwe iinn tÅe roafc tqiouner coef tin
Figure 8q.uewMrcitehot ildneo cwdueiltcahar mBly-eDrd NdouAcpk; l(eeBxd) o Lsf itsnreueq cupteounsrece eo (foC fqGuqCeurGceeArtcAineT tsiThnCoGwwCiintGgh) 2t Bh(Pe- DDmBNa IjAoDr:.i t1y(BA No)fA iSt)su. srtfrauccetuvrei eawwaiyn tfreormac tion of
quercetitnhew mitinhoBr -gDroNovAe; n(uBc)leLoitnideesp; o(Cse) Hofydqruoegrecne btionndshinogw inintegratchtieonms a(3jo) raintdy doifstiatsncset rinu cÅtu orfe qauwercaeytinfr omthe
minorgwroitohv deondueccalmeoetri dduepsl;e(xC o)f Hseyqudernocgee (nCGboCnGdAiAnTgTiCnGteCraGc)2t i(oPnDsB( I3D): a1nBdNAd)i.s tanceinÅofquercetinwith
dodecamerduplexofsequence(CGCGAATTCGCG)9 (PDBID:1BNA).
2
9
26762
Int.J.Mol.Sci.2015,16,26754–26769
Int. J. Mol. Sci. 2015, 16, page–page
Int. J. Mol. Sci. 2015, 16, page–page
FFiigguurree 99.. MMooleleccuulalarrlyly ddoocckkeedd ssttrruuccttuurree ooff kkaaeemmppffeerrooll wwiitthh BB--DDNNAA.. ((AA)) SSuurrffaaccee vviieeww iinntteerraaccttiioonn ooff
Figure 9. Molecularly docked structure of kaempferol with B-DNA. (A) Surface view interaction of
kkaaeemmppffeerrooll wwiitthh BB--DDNNAA;; (B(B))H Hyyddroroggenenb obnodnidnigngin itnertearcaticotniosn(s2 )(2a)n danddis tdainstcaenicneÅ ino fÅk aoefm kpafeemroplfweriothl
kaempferol with B-DNA; (B) Hydrogen bonding interactions (2) and distance in Å of kaempferol
wwdoiittdhhe ddcaoomddeeeccraadmmueeprrl eddxuuppoflleesxxe qoouff essneeqqceuuee(CnnccGeeC ((CCGGGACCAGGTTAACAAGTTCTTGCC)GG2CC(PGGD))22B ((PPIDDD:BB1 BIIDDN:: A11BB).NNAA))..
Figure 10. Molecularly docked structure of galangin with B-DNA. (A) Surface view interaction of
Figure 10. Molecularly docked structure of galangin with B-DNA. (A) Surface view interaction of
gFailgaunrgein1 0w. itMh oBle-DcuNlaArl;y (Bd)o cHkyeddrsotgruenct ubroendofingga lianntegrianctwioinths B(1-)D aNnAd. d(Ais)taSnucref aince Åv ioewf gianlatenrgaicnti ownitohf
galangin with B-DNA; (B) Hydrogen bonding interactions (1) and distance in Å of galangin with
dgoadlaencgaimnewr dituhpBle-Dx NofA se;q(Bue)nHcey d(CroGgCenGAboAnTdTinCgGiCnGte)r2a (cPtDioBn sID(1: )1BanNdAd).i stance in Å of galangin with
ddooddeeccaammeerr dduupplleexx ooff sseeqquueennccee ((CCGGCCGGAAAATTTTCCGGCCGG))2 ((PPDDBB IIDD:: 11BBNNAA))..
2
Table 5. Hydrogen bonds and binding energy data obtained from molecular docking procedure of
Table 5. Hydrogen bonds and binding energy data obtained from molecular docking procedure of
five docked ligands with B-DNA.
fTivaeb ldeo5c.keHdy ldigraongdens wboitnhd Bs-DanNdAb.i ndingenergydataobtainedfrommoleculardockingprocedureof
fivedockCedomligpaonudnsdwsit hBB-iDnNdiAn.g Energy (kcal/mol) Number of Hydrogen Bonds
Compounds Binding Energy (kcal/mol) Number of Hydrogen Bonds
Myricetin −6.13 6
MCyormicpeotiunn ds Bindin−g6E.1n3e rgy(kcal/mol) Numberof6H ydrogenBonds
Fisetin −5.56 4
Fisetin −5.56 4
QuMerycreicteinti n −5.5´5 6.13 3 6
QueFricseettiinn −5.5´5 5.56 3 4
Kaempferol −5.24 2
KaeQmuperfceertoinl −5.2´4 5.55 2 3
Galangin −5.01 1
GKaalaenmgpifne rol −5.0´1 5.24 1 2
Galangin ´5.01 1
The principle conclusions of the above experiments may be stated as follows: (i) The number
The principle conclusions of the above experiments may be stated as follows: (i) The number
and positions of hydroxyl groups in the flavonoid skeleton (Figure 1a) is important in determining
and pTohseitipornins coifp lheycdornocxlyuls giornosuposf itnh ethaeb oflvaevoenxopiedr ismkeenlettsomn a(Fyigbuerset a1tae)d isa ismfoplolortwans:t i(ni) dTehteernmuimnibnegr
the degree of cellular DNA breakage. Solid double headed arrows in Figure 1a also indicate the three
tahned dpegorseitei oonf sceolfluhlyadr rDoNxyAl gbrroeuakpasgien. Sthoelidfl advoounbolied hsekaedleedto anrr(oFwigsu rine F1aig)uisrei m1ap aolrstoa nintdinicadteet ethrme tihnrineeg
most probable group pairs that can form chelates with copper (3–4, 4–5 and 3’–4’) [44]. For
mthoestd epgrroebeaobflec eglrluoluapr DpNairAs bthreaatk acagne. foSromlid cdhoeluabteles hweaitdhe dcoaprproewr s(3i–n4,F i4g–u5r ea1nad a3ls’–o4i’)n d[i4c4a]t.e Ftohre
stereoelectronic reasons, a 4–5 complex cannot be formed from a 3–4 complex; (ii) In addition to the
sttherreeeoemleocsttropnriocb raebalseognrso, ua p4–p5a cirosmthpaletxc caannfnoortm bec hfoerlamteesd wfriothmc ao p3–p4e rco(3m–p4,le4x–; 5(iai)n Idn 3a’d–d4’i)tio[4n4 ]t.o tFhoer
above three copper complexing positions, the other hydroxyl groups in the skeleton may also
asbteorveeo etlhercetreo nciocprpeears ocnosm,pale4x–i5ngc opmopslietixoncsa,n nthoet boethfeorr mhyeddrofrxoyml garo3u–4psc oinm pthleex ;sk(ieil)eItnona dmdaityi oanlstoo
contribute to the DNA breakage capability as these may also form a quinone-like structure once
ctohnetraibbouvtee tthor etheec oDpNpAer bcroemakpalegxei ncgappaobsiiltiitoyn ass, tthheesoet hmerayh yadlsroo xfyolrmgr oau qpusininonthe-eliskkee lsetrtounctumraey oanlcseo
inside the cell. All this will likely contribute to the generation of H2O2 in the cytoplasm as well as in
itcnhoseni dntreui bctlhueetue cste.o lIlnt.h AtehlDils t NchoAisn btwerxieltal, k liitak giesel yicm acppoaonbrtrtiailbintuyt tnaeso ttto ht oteh sfeeo mrggeaenyte tarhalestoi pofneor rommf eHaab2qOiuli2it nyino o ntfhe t-ehl iceky entuostpcrllueacastrmu pr aeosro ewn cceoelmli napssli edinxe
ttthoh ees mncuealcllll. emuAsol.ll eItnchu tihsleiwss [ci4lol5nl]it.k eIext ltiy,s i tca olissno itm rtiobp uboteret natnoott etnhdoe tt hgtoaet nf otehrraeg teditoe tnghreoe fpe Heorf2m Ofleu2aoibnrielitsthcyee oncfcy etth oeepn nlhauasncmlceeaamrs pewnoetr le(l Fcaiosgmuinrpelt eh2x)e
to small molecules [45]. It is also to be noted that the degree of fluorescence enhancement (Figure 2)
of various flavonoids upon binding to DNA follows the same pattern as the capacity of flavonoids to
of various flavonoids upon binding to DNA foll2o6w76s 3the same pattern as the capacity of flavonoids to
10
10
Description:Hussain Arif 1, Nida Rehmani 1, Mohd Farhan 1, Aamir Ahmad 2,* and Sheikh . increased tail lengths of comets, compared to control cells (p < 0.01).