Table Of ContentTopically Delivered Adipose Derived Stem Cells Show an
Activated-Fibroblast Phenotype and Enhance
Granulation Tissue Formation in Skin Wounds
Seok Jong Hong1*, Sheng-Xian Jia1., Ping Xie1., Wei Xu1, Kai P. Leung2, Thomas A. Mustoe1,
Robert D. Galiano1*
1Department of Surgery/Division of Plastic and Reconstructive Surgery, Laboratory for Wound Repair and Regenerative Medicine, Feinberg School of
Medicine,NorthwesternUniversity,Chicago,Illinois,UnitedStatesofAmerica,2MicrobiologyBranch,USArmyDentalandTraumaResearchDetachment,Instituteof
SurgicalResearch,FortSamHouston,Texas,UnitedStatesofAmerica
Abstract
Multipotentmesenchymalstemcells(MSCs)arefoundinvarioustissuesandcanproliferateextensivelyinvitro.MSCshave
been used in preclinical animal studies and clinical trials in many fields. Adipose derived stem cells (ASCs) have several
advantages compared to other MSCs for use in cell-based treatments because they are easy to isolate with relative
abundance. However, quantitative approaches for wound repair using ASCs have been limited because of lack of animal
models which allow for quantification. Here, we addressed the effect of topically delivered ASCs in wound repair by
quantitative analysis using the rabbit ear model. We characterized rabbit ASCs, and analyzed their multipotency in
comparison to bone marrow derived-MSCs (BM-MSCs) and dermal fibroblasts (DFs) in vitro. Topically delivered ASCs
increased granulation tissue formation in wounds when compared to saline controls, whereas BM-MSCs or DFs did not.
ThesestudiessuggestthatASCsandBM-MSCsarenotidentical,thoughtheyhavesimilarsurfacemarkers.Wefoundthat
topicallydeliveredASCsareengraftedandproliferateinthewounds.WeshowedthattransplantedASCsexhibitedactivated
fibroblast phenotype, increasedendothelial cellrecruitment, and enhancedmacrophage recruitment invivo.
Citation:HongSJ,JiaS-X,XieP,XuW,LeungKP,etal.(2013)TopicallyDeliveredAdiposeDerivedStemCellsShowanActivated-FibroblastPhenotypeand
EnhanceGranulationTissueFormationinSkinWounds.PLoSONE8(1):e55640.doi:10.1371/journal.pone.0055640
Editor:LeonardEisenberg,NewYorkMedicalCollege,UnitedStatesofAmerica
ReceivedAugust27,2012;AcceptedDecember28,2012;PublishedJanuary31,2013
Thisisanopen-accessarticle,freeofallcopyright,andmaybefreelyreproduced,distributed,transmitted,modified,builtupon,orotherwiseusedbyanyonefor
anylawfulpurpose.TheworkismadeavailableundertheCreativeCommonsCC0publicdomaindedication.
Funding:ThisstudywassupportedbytheUnitedStatesArmyMedicalResearchandMaterialCommand(W81XWH-10-2-0054).Flowcytometrywassupported
bytheNorthwesternUniversityFlowCytometryFacilityandaCancerCenterSupportGrant(NCICA060553).Thefundershadnoroleinstudydesign,data
collectionandanalysis,decisiontopublish,orpreparationofthemanuscript.
CompetingInterests:Theauthorshavedeclaredthatnocompetinginterestsexist.
*E-mail:[email protected](SJH);[email protected](RG)
.Theseauthorscontributedequallytothiswork.
Introduction degradationoftherapeuticgrowthfactorsinthewoundsiteorthe
requirement for the administration of these growth factors in a
Woundrepairisacomplexanddynamicprocesswhichconsists proper spatiotemporal sequence in order to improve wound
of inflammation, angiogenesis, and tissue formation and remod- repair. Recent progress in regenerative medicine has suggested
eling[1,2,3].Uponinjury,fibrinclotsaredepositedonthewound multipotentstemcellsorprogenitorcellsfortissuerepair[5,6,7,8].
site to prevent hemorrhage. Circulating platelets migrate to the
Itisthoughtthatthetransplantedstemcellsorprogenitorcellscan
wound and release inflammatory signals such as transforming
integrate themselves to the environment and control the wound
growth factor-b (TGF-b), platelet-derived growth factor (PDGF),
repairprocessbysecretingfactorsandcommunicatingwithother
and epidermal growth factor (EGF). This is followed by the
cellstoimprovetheclinicaloutcomeofwoundrepair.Inaddition,
infiltration of neutrophils and macrophages and the migration of
stem cells could mediate wound repair by replacing damaged
keratinocytestothewoundtorecoverthebarrierfunctionofskin.
tissue by both differentiating into the required cells and inducing
Endothelial cells and fibroblasts migrate to the site and build up
surrounding cells todedifferentiate toreplace thetissues.
granulation tissues by depositing collagen and other extracellular
MSCs have been isolated from various tissues such as bone
matrices.Duringthefinalstagesofrepair,fibroblastsremodelthe
marrow,adiposetissue,umbilicalcordblood,skeletalmuscle,and
collagen by producing matrix metalloproteinases (MMPs) over a
brain [7,9]. MSCs have ability to attach to plastic to form
course of several months. Thus wound repair is a highly
fibroblast-likecoloniesandtoproliferateextensivelyinvitro.MSCs
orchestrated sequential process in which signals of one cell type
can be differentiated into multiple lineage cells: chondrocytes,
regulate othercell typesina cascade.
cardiomyocytes,adipocytes,osteoblasts,endothelial,andneuronal
Growthfactorshavebeenusedtoimprovetheclinicaloutcome cells[7,10,11,12,13].AmongMSCs,ASCscanbeeasilyobtained
of the wound repair process. It has become clear that the use of in large quantities with minimal morbidity and invasiveness
growth factors, specifically as single-agent therapies, has limited [14,15,16].ASCsactivaterepairprocessesinaparacrinemanner
impactonwoundrepair[4].Thiscouldbepartlyduetotherapid
by secreting cytokines and growth factors, such as vascular
PLOSONE | www.plosone.org 1 January2013 | Volume 8 | Issue 1 | e55640
Report Documentation Page Form Approved
OMB No. 0704-0188
Public reporting burden for the collection of information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources, gathering and
maintaining the data needed, and completing and reviewing the collection of information. Send comments regarding this burden estimate or any other aspect of this collection of information,
including suggestions for reducing this burden, to Washington Headquarters Services, Directorate for Information Operations and Reports, 1215 Jefferson Davis Highway, Suite 1204, Arlington
VA 22202-4302. Respondents should be aware that notwithstanding any other provision of law, no person shall be subject to a penalty for failing to comply with a collection of information if it
does not display a currently valid OMB control number.
1. REPORT DATE 2. REPORT TYPE 3. DATES COVERED
01 JAN 2013 N/A -
4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER
Topically Delivered Adipose Derived Stem Cells Show an
5b. GRANT NUMBER
Activated-Fibroblast Phenotype and Enhance Granulation Tissue
Formation in Skin Wounds 5c. PROGRAM ELEMENT NUMBER
6. AUTHOR(S) 5d. PROJECT NUMBER
Hong S. J., Jia S-X., Xie P., Xu W., Leung K. P., Mustoe T. A., Galiano R.
5e. TASK NUMBER
D.,
5f. WORK UNIT NUMBER
7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION
United States Army Institute of Surgical Research, JBSA Fort Sam REPORT NUMBER
Houston, TX
9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM(S)
11. SPONSOR/MONITOR’S REPORT
NUMBER(S)
12. DISTRIBUTION/AVAILABILITY STATEMENT
Approved for public release, distribution unlimited
13. SUPPLEMENTARY NOTES
14. ABSTRACT
15. SUBJECT TERMS
16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF 18. NUMBER 19a. NAME OF
ABSTRACT OF PAGES RESPONSIBLE PERSON
a. REPORT b. ABSTRACT c. THIS PAGE UU 11
unclassified unclassified unclassified
Standard Form 298 (Rev. 8-98)
Prescribed by ANSI Std Z39-18
ASCsinWoundHealing
endothelial growth factor (VEGF), TGF-b, granulocyte/macro- Ficoll-Paque Plus (1.077 g/ml, GE Healthcare, Piscataway, NJ)
phagecolonystimulatingfactor(GM-CSF),stromalderivedfactor and centrifuged at 2,0006g for 30minutes. The interface layer
1 (SDF-1), and hepatocyte growth factor (HGF) [13,17,18,19]. containing BM-MSCs was recovered and washed in HBSS. BM-
Thesecellsalsorecruitendogenousstem(orprogenitor) cellsand MSCswerethenculturedinMinimumEssentialMedium(MEM)
can stimulate them to differentiate into the required cell types. containing 10%FBS.
ASCssuppressimmunereactionsandhavereducedhistocompat- FortheisolationofrabbitDFs,skintissuewascutintosquared
abilityantigens[20,21,22,23].ASCshavebeenusedinpreclinical pieces(,161 cm2)andplacedwiththeepidermisfacedownina
animals studies and clinical trials in the field of reconstructive dish.Dispase(LifeTechnologies,Carlsbad,CA)with5 mg/mlin
surgery, orthopedics, andimmunediseases [7,15,24,25]. PBSwasaddedandincubatedovernightat4uC.Dermaltissuewas
Manyanimals-suchasmouse,rat,rabbit,andpig-havebeen mincedmanuallyafterremovingepidermaltissueanddigestedin
used in wound healing studies. However, there is no ideal model 0.25% collagenase type II (Life Technologies) in HBSS at 37uC
which exactly resembles human wounds. For example, open overnight. The solution was filtered through a 100mm sterile
wounds in rodents heal quickly primarily due to wound nylon mesh filter and spun at 5006g for 10minutes. The pellet
contraction because of the subcutaneous panniculus carnosus was then resuspended in DMEM medium containing 10% FBS
muscle, which is not characteristic of human wounds. Rather, andcultured in culture dishes.
human skin wounds heal to a significant degree by generation of
new tissue (granulation tissue and re-epithelialization) in addition In vitro differentiation of MSCs to mesodermal lineage
tocontraction.Thus,thoughASCsareapromisingcandidatefor For adipogenic differentiation, MSCs were seeded in 24 well
cell therapy in wound repair, there have been limitations in the plates at a concentration of 26104 and cultured in adipogenesis
quantitative analysis of wound repair [26,27,28,29]. The rabbit differentiationmedium(LifeTechnologies).After8daysculturing,
earmodelhasauniqueadvantageinwoundhealingstudybecause cellswerefixedin4%paraformaldehydeandOilRedOstaining
of the ability to evaluate the role of therapeutic treatment in was performed to detect intracellular lipid accumulation. For
wounds by quantification of epithelialization and granulation osteogenicdifferentiation,MSCswereseededincollagen(50 mg/
tissue formation [30,31,32,33]. In addition, the presence of a ml)coated24wellplatesataconcentrationof16104andcultured
cartilage wound base acts to stent open the wound and prevent in osteogenesis differentiation medium (Life Technologies) for 28
contraction. In this report, we addressed the effect of topically or35days.Cellswerefixedin4%paraformaldehydeandAlizarin
deliveredASCsinwoundrepairbyquantitativeanalysisusingthe RedSstainingwasperformedtodetectaccumulatedcalcium.For
rabbit ear model. We characterized rabbit ASCs, and analyzed chondrogenic differentiation, a total of 86104 MSCs in 20ml of
theirmultipotencyincomparisontoBM-MSCsandDFsinvitro.In culturemediumwereplatedinthemiddleof24wellplates.After
addition, the effect of wound healing by ASCs treatment was 3 hours incubation, chondrogenesis differentiation medium was
compared to BM-MSCs and DFs treatment. Wound analysis provided(LifeTechnologies).After14or21daysofculture, cells
suggests that topically delivered ASCs exhibit activated fibroblast were fixed in 4% paraformaldehyde. Then, Alcian Blue Staining
phenotype, enhance macrophage recruitment, and increase wasperformed,whichdetectedsulfatedproteoglycanrichmatrix.
granulation tissueformation inwounds.
Reverse transcription-quantitative PCR (RT-qPCR) and
Materials and Methods Western blot analysis
Total RNA was prepared by treatment with Trizol Reagent
Isolation and culture of ASCs, BM-MSCs, and DFs
(Sigma-Aldrich, St.Louis, MO)andgenomicDNA was removed
ASCs were isolated as described previously with some using theTurbo DNA-free kit (Ambion,Austin, TX).cDNA was
modification [11,31,34,35]. Briefly, inguinal fat pads were made from total RNA using superscript II (Invitrogen, Carlsbad,
dissected out from young female New Zealand White rabbits (3– CA) with random primers. PCR was performed to detect
6 months old, ,2–4kg) and placed in sterile, pre-warmed expression of mRNAs. For the quantitative analysis, RT-qPCR
phosphate-buffered saline (PBS). Fat pads were then washed analysesusingSYBRgreenIwereperformedusinganABIprism
several times in PBS, minced manually, and digested in 0.075% 7000sequencedetectionsystem(AppliedBiosystems,FosterCity,
collagenase type II in Hank’s Buffered Salt Solution (HBSS) for CA). Expression of each gene was normalized to the level of
1 hour at 37uC in a shaking water bath. The stromal vascular glyceraldehyde-3-phosphatedehydrogenase(Gapdh)togetaDCt.
fraction (SVF) containing ASCs was isolated by centrifugation at The 22DDCt method was used to calculate gene expression
5006g for 5 minutes, resuspended in HBSS, filtered through a differencebetweendifferentiatedandcontrolsamples.Expression
100mm sterile nylon mesh filter, and then spun again at 5006g ofgeneswasdetectedbyPCRwiththefollowingoligonucleotides
for 5 minutes. The resultant pellet was resuspended in 10ml of – Gapdh (59- AGGTCATCCACGACCACTTC -39 and 59-
red blood cell (RBC) lysis buffer (10mM KHCO3, 150mM GTGAGTTTCCCGTTCAGCTC -39), adiponectin (59-
NH4Cl,0.1mMEDTA),andallowedtositatroomtemperature CCTGGTGAGAAGGGTGAAAA -39 and 59- GCTGAGCGG-
for 10minutes. The supernatant was removed by centrifugation TAGACATAGGC -39), osteopontin (59- AGGATGAGGAC-
followingRBClysisandthepelletwasresuspendedinDulbecco’s GATGACCAC -39 and 59- CACGGCCGTCGTATATTTCT -
Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12) 39), col10a1 (59- GGAAAACAAGGGGAGAGAGG -39 and 59-
containing 10% fetal bovine serum (FBS, Thermo Scientific, CCAGGAGCACCATATCCTGT -39).
Rockford,IL)andplatedinculturedishes.Afterovernightculture, For Western blot analysis, MSCs were washed with PBS,
the media was then removed and replaced with fresh culture harvested,andlysedwithRIPAbuffer(150 mMNaCl,1%NP-40,
medium.ThemediumwaschangedtwiceaweekandASCswere 0.5% deoxycholic acid, 0.1% SDS, 50mM Tris-HCl, pH 7.5).
subcultured whentheyreached 80–90%confluency. EqualamountsofproteinwereaddedtoaSDSpolyacrylamidegel
BM-MSCswereisolatedfromthefemoralmedullarycavitiesof and transblotted on nitrocellulose membranes. Membranes were
rabbits.BonemarrowwascollectedinPBScontaining2 units/ml incubated with anti-CD29 (1:5,000 dilution; Abcam, Cambridge,
heparin and left at room temperature for 10minutes. After MA), anti-CD44 (1:5,000 dilution; Abcam), anti-CD90 (1:5,000
removingthefloatingfatlayer,thesolutionwasaddedto5 mlof dilution; Abcam), or anti-CD105 (1:2,500 dilution, Abcam) and
PLOSONE | www.plosone.org 2 January2013 | Volume 8 | Issue 1 | e55640
ASCsinWoundHealing
then incubated with horseradish peroxide-conjugated secondary using 3,39-diaminobenzidine (DAB). Hematoxylin was used as a
antibody(1:5,000dilution;VectorLaboratories,Burlingame,CA). counterstain. Mouse anti- alpha smooth muscle actin (a-SMA,
Specific bands were visualized using an Enhanced Chemilumi- 1:2,000 dilution, Santa Cruz Biotechnology, Santa Cruz, CA),
nescence (ECL) detection kit (GE Healthcare). The blots were mouseanti-neutrophilMarker(RPN3/57,1:1,000dilution,Santa
probed with anti-b-actin antibody (1:5,000 dilution; Sigma– Cruz Biotechnology), mouse anti-CD3 (1:1,000 dilution, Santa
Aldrich) to serve as a control for gel loading. The intensity of Cruz Biotechnology), and mouse anti-macrophage (1:1,000
signal was measured using the NIH image program (ImageJ, dilution, Abcam) were usedasprimary antibodies.
http://rsb.info.nih.gov/ij/). For immunofluorescence microscopy, chicken anti-GFP (1:200
dilution, Life Technologies), a-SMA (1:200 dilution, Santa Cruz
Labeling of ASCs with green fluorescence protein (GFP) Biotechnology), mouse anti-collagen III (col3, 1:200 dilution,
TostablyexpressGFP,ASCsweretransducedwithalentivirus Novus Biologicals, Littleton, CO), mouse anti-CD31 (1:25
(LV-GFP)inwhichGFPexpressionisdrivenbyacytomegalovirus dilution, Abcam), mouse anti-Ki67 (1:20 dilution, Novocastra,
(CMV) promoter according to the manufacturer’s protocol (Life Buffalo Grove, IL), and mouse anti-PCNA (1:100 dilution, BD
Technologies). Briefly, 2 multiplicity of infection (MOI) of Biosciences, San Jose, CA) antibodies were used as primary
lentivirus was infected to ASCs in the presence of 6mg/ml of antibodies. Alexa Fluor 488 or 555 conjugated secondary
polybrene.Transducedcellswereselectedbytreating10 mg/mlof antibodies were usedto detect theprimary antibody (Invitrogen).
blasticidin. GFP expressing cells were further selected by flow Nuclei were stained with 49,6-diamidino-2-phenylindole (DAPI,
cytometry using the Northwestern University Flow Cytometry 1 mg/ml).
Facility.
Results
Treatment of MSCs to the full thickness excisional
Isolation and characterization of rabbit ASCs
wounds of rabbit ears
RabbitASCshavespindleshapesduringinvitroprimaryculture
Young, adult New Zealand White rabbits (3–6 months, ,2–
andaremorphologicallysimilartoDFs(Figure1A&1C).Rabbit
4 kg)wereacclimatedtostandardhousingandfedadlibitumunder
BM-MSCs have a larger surface area compared to ASCs
an experimental protocol approved by the Northwestern Univer-
(Figure1B).WecharacterizedASCsbyanalyzingsurfacemarkers
sity Animal Care and Use Committee (protocol number: 2010-
and multipotency of differentiation. Unlike embryonic stem cells,
1841). Rabbits were anesthetized with an intramuscular injection which have specific makers such as Oct-4 and SSEA, MSCs
ofketamineandxylazineasdescribed[31,32].Woundsweremade cannot be characterized by specific markers because definitive
witha7 mmsurgicalpunchbiopsy(Acuderm,Ft.Lauderdale,FL) cellular markers are not yet identified. Thus, a series of positive
downto,butnotthrough,thecartilage.Sixwoundswerecreated and negative surface markers are needed for the characterization
perear.Tissuewasthenelevatedinanefforttoremoveepidermis ofMSCs[7,9,13,15,16,25,36].WeselectedCD29,CD44,CD90,
and dermis, but leave the perichondrium intact. MSCs were andCD105aspositivemarkers.Twohematopoieticcellmarkers,
topically delivered to wounds in a specific manner to allow each CD34 and CD45, were used as negative markers. Given the
animal to serve as its own internal control; for example, MSCs limited information of antibodies in rabbit protein, we tested
were delivered into 6 wounds on the one ear and saline was antibodies that were designed to detect human antigens. Speci-
delivered into 6 wounds on the contralateral ear of the rabbits. ficityofantibodies,exceptCD45,wasconfirmedbyWesternblot
Wounds are then covered with semi-occlusive dressings (Tega- analysis (data not shown). Expression of CD34 was detected in
dermTM,3MHealthCare,St.Paul,MN).Woundswereharvested neither ASCs nor BM-MSCs (data not shown). We tested
with a 10mm surgical punch biopsy tool (Acuderm) at post- antibodies from four different vendors but could not find
operativeday(POD)7aftereuthanizationwiththeadministration antibodies which are specific to rabbit CD45 protein (data not
of intracardiac Euthasol followed by a bilateral thoracotomy to shown). Expression of CD29, CD44, CD90, and CD105 was
assurethedeathofrabbits.Woundswereimmersedin10%zinc- detected without significant changes, though minor variations
formalin forfixation. werefoundwhenquantifiedwiththeNIHImageJprogram,from
passage 1 through passage 9 both in ASCs (Figure 1D) and BM-
Histological and immunochemical analysis of wounds MSCs(Figure S1).
Formalin-fixed wounds were processed, embedded in paraffin
blocks,andthensectionedonamicrotomeatathicknessof4mm. Multi-lineage differentiation potential of ASCs
Thesectionswerestainedwithhematoxylinandeosin(H&E)and WeaddressedthemultipotencyofASCs,andcomparedthemto
histological analysis - epithelial gap and granulation area - was BM-MSCsandDFs.Foradipogeneis,OilRedOstainingshowed
performed using a Nikon Eclipse 50i light microscope and NIS an accumulation of lipid droplets in the cytoplasm of ASCs and
ElementsBRsoftware(Nikon,Melville,NY).Slideswereanalyzed BM-MSCswhichweregrowninadipogenesismediumfor8days
and scored in a blinded fashion and statistical analysis was (Figure2A&B).Incontrast,fewerlipiddropletswerefoundinthe
performed using the Student’s t-test (two-tailed and unpaired) cytoplasm of DFs (Figure 2C). Alcian Blue staining showed
when comparing 2 study groups, and 1-way analysis of variance positive signals in ASCs and BM-MSCs which were cultured in
(ANOVA) when comparing the means of multiple groups. The chondrogensismediumfor14daysandsignalswerestrengthened
level of significance will be set at p,0.05. The n numbers in the at day 21 culture (Figure 2D & E). Alcian Blue staining positive
histological analysis figures represent total wounds from different signals were found in DFs culture, though those signals were
rabbits whichhad6 woundsper ear. weaker compared to ASCs and BM-MSCs (Figure 2F). Accumu-
For the immunostaining, sections were treated with antigen latedcalciumwasdetectedinASCsandBM-MSCsbutnotinDFs
retrieval solution (Dako, Carpinteria, CA) by boiling for 20min- by Alizarin Red S staining at day 28 culture in the osteogenesis
utesbeforeantibodytreatment.Forimmunohistochemistry(IHC), medium (data not shown). Both ASCs and BM-MSCs showed a
the signal was detected using the Vectastain kit (Vector highaccumulationofcalciumatday35culture(Figure2G&H).
laboratories) after primary antibody treatment and visualized DFs also showed an accumulation of calcium, although it was a
PLOSONE | www.plosone.org 3 January2013 | Volume 8 | Issue 1 | e55640
ASCsinWoundHealing
Figure1.MorphologyandsurfacemarkersofrabbitMSCs.(A–C):BrightfieldimagesofrabbitASCs(A),BM-MSCs(B),andDFs(C).Cellswere
growninculturedisheswithgrowthmediumandphotosweretaken.Scalebar;100mm.(D):Westernblotanalysis.WholecellextractofrabbitASCs
frompassage1(P1)toP9waspreparedandloaded20mgperwell.TheexpressionofCD29,CD44,CD90,andCD105weredetectedwiththeirspecific
antibodiesasindicated.b-actinwasdetectedasaloadingcontrol.
doi:10.1371/journal.pone.0055640.g001
smalleramountcomparedtoASCsandBM-MSCsintheday35 differences such as epithelial gap and granulation tissue areas
culture (Figure 2I). were digitally quantified as previously described (Figure S3)
We analyzed the expression of specific genes of adipocyte, [30,31]. All three concentrations of ASCs increased granulation
osteocyte, and chondrocyte lineages by RT-qPCR [11]. Expres- tissue area (data not shown). Wounds treated with highest ASCs
sion of an adipocyte specific gene, adiponectin, was increased by number - 36105 - had a larger epithelial gap. This means there
35-fold and 17-fold in ASCs and BM-MSCs, respectively, when was minor inhibition of keratinocyte migration, though this was
culturedinadipogenicmediumfor8days(FigureS2A).However, not statistically significant(data not shown).
inductionofadiponectininDFswasnotfoundinthesameculture To determine the dose of ASCs which does not inhibit
condition. Expression of an osteocyte specific gene, osteopontin, epithelialization but increases granulation tissue formation,
was increased by 3.2-fold and 2.7-fold in ASCs and BM-MSCs, wounds on one ear were treated with 16105 ASCs and wounds
respectively. This increase in gene expression was not found in on thecontralateral ear were treated with 36104ASCs. Wounds
DFs when it was cultured in osteogenic medium for 28 days with 16105 ASCs (n=11) had similar epithelial gaps
(FigureS2B).Expressionofachondrocytespecificgene,Col10a1, (4.35+0.42 mm, Figure S4A) compared to wounds with 36104
wasincreasedby6-fold,12-fold,and1,515-foldinDFs,ASCs,and ASCs (n=12, 4.09+0.32 mm). However, wounds treated with
BM-MSCs, respectively, when cultured in chondrogenic medium 16105ASCsshowedgreatergranulationtissuearea,thoughitdid
for21days(FigureS2C).TheseresultssuggestthatASCsandBM- not reach statistically significance (Figure S4B, 1.4860.21 vs.
MSCs have differential properties, though they share similar 0.9560.13mm2,p=0.09).Thuswedeterminedthat16105ASCs
surface markers and have multilineage differentiation potential. as an optimumnumber for woundhealing study.
ASCs and BM-MSCs are prone to differentiate into adipocytes Next, we increased the number of wounds and animals to
and chondrocytes, respectively. DFs have less multipotency increase power of statistical analyses. With each rabbit serving as
compared toASCs andBM-MSCs. its own internal control, 16105 of P3 ASCs were delivered to
woundsononeearandthewoundsoncontralateralearreceived
ASCs enhance granulation tissue formation in wounds saline alone as control as described above and wounds were
TodeterminetheoptimalquantityofASCstopromotewound analyzed at POD7. When compared to saline treated control
healing, we treated wounds with different amounts of ASCs. wounds, ASCs treated wounds showed increased granulation
ThoughweshowedtheconservationofsurfacemarkersofASCsin tissue area (0.5060.07mm2 vs. 1.1360.14 mm2, p=0.0001,
vitro, weused an early passage (P3) ASCs inthese experiments to Figure 3A). ASCs treatment did not affectepithelialization of the
avoidchangesofcharacteristicsofASCsoverthelongterminvitro epidermis when compared to saline treated wounds
culture. ASCs were harvested, washed in PBS to remove cell (4.0360.31mm vs. 3.9160.26 mm, respectively; p=0.8, Figure
culture medium, and resuspended in PBS. Three different S5). For comparison, 16105 of P3 BM-MSCs (or DFs) were
amounts of ASCs - 36105, 16105, and 36104 - in 7 ml of PBS deliveredtowoundsononeearandsalinecontrolweredelivered
were delivered to each 7 mm wound of one ear. In the to wounds on the contralateral ear. We found that granulation
contralateral ear, 7ml of PBS were delivered to each wound as a tissue area was not significantly changed by BM-MSCs
control. Wounds were harvested at POD7 and histological (0.96+0.32 mm2 vs. 1.15+0.13mm2, Figure 3B) or DFs
PLOSONE | www.plosone.org 4 January2013 | Volume 8 | Issue 1 | e55640
ASCsinWoundHealing
Figure2.RabbitMSCsdifferentiatetomesodermallineagesinvitro.Passage2ASCs(A,D,G),BM-MSCs(B,E,H),andDFs(C,F,I)wereused
fordifferentiation.(A–C):Adipogenicdifferentiation.Cellswereculturedinadipogenesisdifferentiationmediumfor8days.OilRedOstainingwas
performed to detect lipid accumulation. Nuclei were stained with Hematoxylin. (D–F): Chondrogenic differentiation. Cells were cultured in
chondrogenesis differentiation medium for 21 days. Alcian blue staining was performed.(G–I): Osteogenic differentiation. Cells were cultured in
osteogenesis differentiation medium for 35 days. Alizarin Red S staining was performed to detect calcium accumulation. Abbreviation: MSCs,
mesenchymalstemcells;ASCs,adiposederivedstemcells;DFs,dermalfibroblasts;BM-MSCs,bonemarrowderivedmesenchymalstemcell.Scalebar;
(A–F)50mm,(G–I)100mm.
doi:10.1371/journal.pone.0055640.g002
(0.6260.10mm2vs.0.7060.10mm2,Figure3C)treatmentwhen Interestingly, the majority of transplanted ASCs showed a-SMA
compared to saline treated wounds. We also performed an signal (cells with yellow color, Figure 4C, D, F, G & Figure S7).
ANOVA test to compare the effect of three different cell types - WealsoobservedASCswhichdidnotexpress a-SMA(cellswith
ASCs, BM-MSCs, and DFs, on wound repair (Figure S6). The green color,Figure 4 &Figure S7).
posthoct-testshowedthesignificantdifferencebetweentheASCs We next analyzed expression of collagen III (Col III), which is
and DFs, BM-MSCs and DFs, while there’s no statistically produced by myofibroblasts before synthesis of mechanically
significant difference between ASCs and BM-MSCs. However, stronger collagen I. Expression of Col III was detected in wound
given the variation among rabbits which are not syngeneic, each bed(FigureS8A,C,E)andgranulationtissue(FigureS8A,D,F),
rabbit served as its own internal control in our wound healing thoughthesignalwasweak.ExpressionofColIIIwasdetectedin
analyses. Thus, we think that the Student t-test is more accurate the outside of wounded area (Figure S8A & B). Transdifferentia-
than theANOVA test forour purpose. tion of ASCs to endothelial cells was addressed using a platelet
endothelial cell adhesion molecule (PECAM-1, CD31) - specific
Transplanted ASCs exhibit activated fibroblast antibody. Expression of CD31 was prominently detected in the
phenotype granulationtissue(FigureS9).However,co-expressionofCD31in
transplantedASCswasnotdetected(FigureS9).Thus,transdiffer-
Wound healing is a complex process in which interactions of
entiationoftransplantedASCstoendothelialcellwasnotfoundat
diversecelltypesandcytokinesareinvolved.ASCscancontribute
POD7 in the rabbit wounds. Proliferation of transplanted ASCs
towoundhealingbyeithercytokineexpression,ordifferentiation
wasdetectedwithKi-67orPCNAspecificantibodies(Figure5&
andrepopulationinwounds.WeanalyzedthetransplantedASCs
Figure S10).
in wounds using GFP-expressing ASCs (GFP-ASCs). A total of
16105 GFP-ASCs in saline was delivered into each wound.
Wounds were harvested at POD7 and histological analysis was Analysis of cells involved in wound healing in the ASCs
performed.Immunofluorescencestainingwithanti-GFPantibody treated wounds
showed that transplanted ASCs were evenly distributed in the WefurtheranalyzedASCstreatedwoundsimmunohistochem-
wound bed and granulation area (Figure 4A & Figure S8A). icallyandcomparedthemwithsalinetreatedwounds.Expression
Duringthewoundrepairprocess,fibroblastsmigratetothewound of a-SMA was found in the granulation tissue of ASCs treated
site and build up granulation tissue by depositing collagen and woundsandsalinetreatedcontrolwounds(Figure6A,E).a-SMA
other extracellular matrices [37,38]. These activated myofibro- signalsinASCstreatedwounds(Figure6E)arefromendogenous
blasts are characterized by a-SMA expression. Immunofluores- activatedfibroblastcellsandtransplantedASCs(Figure4&Figure
cence staining with anti-a-SMA antibody detected endogenously S7). a-SMA signals in Figure 6A are from endogenous activated
activated fibroblasts (cells with red color, Figure 4 & Figure S7). fibroblast cells. The transplanted ASCs are allogeneic because
PLOSONE | www.plosone.org 5 January2013 | Volume 8 | Issue 1 | e55640
ASCsinWoundHealing
Figure 3. Histological quantification of MSCs treated wounds. (A–C): A total of 16105 ASCs (A), BM-MSCs (B), and DFs (C) in PBS were
delivered to 7mm wounds on one ear. In the contralateral ear, PBS alone was delivered as a control. Wounds were harvested at POD7 and
granulationtissueareawasmeasured.Numberofwoundsanalyzed;(A,n=35forsaline&n=36forASCs;B,n=17forsaline&n=20forBM-MSCs,C,
n=17forsaline&n=24forDFs).Nrepresentsthetotalnumberofwoundsfromsix(A)orfour(B,C)rabbits.Datashownasmean+SEM.***p,0.001,
ns=notsignificant.
doi:10.1371/journal.pone.0055640.g003
syngeneic rabbits are not available. We investigated whether increase endothelial cell recruitment, and enhance wound repair
transplanted allogeneic ASCs evoke immune reactions in vivo, by macrophagerecruitment.
thoughimmunemodulatorypropertyofASCshasbeenproposed
[16,20,21,39]. Neither CD3 (T cell antigen) nor CD45 (common Discussion
leukocyte antigen) positive signals were found by their specific
BM-MSCs were first isolated among various MSCs and have
antibodies in ASCs treated wounds at POD7 (Figure 6F & data
potentialtocontributetowoundrepairinmanytissues.However,
notshown).Angiogenesisisoneofcriticalfactorsinwoundrepair
the procedure for extracting BM-MSCs is relatively invasive and
process. Blood vessel formation in granulation tissue, which is
could cause patient morbidity. Extended time is required to
determined by endothelial marker (CD31) staining, was detected
expandBM-MSCsinculturetogetalargeenoughnumberofcells
in ASCs treated wounds and control wounds (Figure 6C, G).
for clinical uses. ASCs have several advantages compared with
Interestingly, a few CD31 positivecells were foundinthewound
BM-MSCs because they are easy to isolate with relative
beds of ASCs treated wounds, though blood vessel structure was
abundance [9,14,27]. ASCs and BM-MSCs have similar surface
not found (Figure 6H). In contrast, we could not detect CD31
markers,cytokinesandgeneexpressionprofiles[7,9,16,42].Thus,
positivecellsinthewoundbedsofsalinetreatedwoundsatPOD7
weselectedASCsasacelltherapyreagentforwoundrepairinthis
(Figure6D).Sincetransdifferentiation ofASCtoendothelialcells
report and compared their properties to BM-MSCs. The
was not found at POD7 in our animal model (Figure S9), we
mesodermallineagedifferentiationexperimentsuggeststhatASCs
suggestthatASCsincreaseendothelialcellrecruitmentinwounds.
are more likely to differentiate into adipocytes, while BM-MSCs
Neutrophils migrate to wounded sites upon injury and initiate
are prone to differentiate into chondrocytes (Figure 2). ASCs
an initial inflammatory phase for wound repair. Then, macro-
engrafts enhanced granulation tissue area in rabbit ear wounds,
phagesmovetothesitesandsecretecytokinesandgrowthfactors
whileBM-MSCsengraftsdidnotincreasegranulationtissuearea
which attract cells involved in wound repair [40,41]. They
(Figure 3). It is known that granulation tissue formation is not
participate in remodeling the extracellular matrix and forming
always beneficial because prolonged activation of fibroblasts in
granulationtissuetorepairwounds.Wedidnotdetectasignificant
dermis increases granulation tissue formation and results in
numberofneutrophilsatPOD7woundsinwhichASCsorsaline
hypertrophicscar[1,43,44].However,itisnoteasytotellwhether
controlsweretreated(Figure7A,B).Wedetectedaverageof16.4
the granulation tissue is healthy or not in early phase, the time
macrophages in the granulation tissue near to the migrating
window we analyzed, because formation of granulation tissue is
epidermiswithhighpowermicroscopicfields(HPF,Figure7C,E).
essential during the wound healing process. We have done initial
The number of macrophages in the granulation tissue was
experimentsanalyzingtheeffectsofMSCsonscarringandfound
markedly increased by ASCs treatment at POD7 (Figure 7D, E).
no evidence of increased scarring with MSCs in spite of their
Thus, our wound analyses (through Figures 3 to 7) suggest that
increasedcellularityinthewoundhealingexperiments.However,
transplanted ASCs exhibit the activated fibroblast phenotype,
inananalysisofscarformationat28days,therewasnosignificant
PLOSONE | www.plosone.org 6 January2013 | Volume 8 | Issue 1 | e55640
ASCsinWoundHealing
Figure4.TransplantedASCsexpressa-SMAinwounds.GFP-expressingASCswereanalyzed7daysaftertransplantationinwounds.Chicken
anti-GFPandmouseanti-a-SMAantibodieswereusedtodetectGFPanda-SMA.NucleiwerestainedwithDAPI.(A):Lowmagnificationofwounds.
TheareasanalyzedinFigure6wereindicatedby‘a’and‘b’.(B–D):HighermagnificationsoftheindicatedregionsinA(whitesquares;labeledasi,ii,
iii).(E–G):HighermagnificationsoftheindicatedregionsinB–D(whitesquares;labeledasiv,v,vi).Mergedimagesofa-SMA(red)andGFP(green)
indicatethata-SMAisexpressedinASCs.Scalebars:500mm(A),50mm(B–G).
doi:10.1371/journal.pone.0055640.g004
Figure5.TransplantedASCsproliferateinwounds.GFP-expressingASCswereanalyzed7daysaftertransplantationinwounds.Chickenanti-
GFP(A)andmouseanti-Ki67(C)antibodieswereused.NucleiwerestainedwithDAPI(B).MergedimagewasshowninD.Scalebars:50mm.
doi:10.1371/journal.pone.0055640.g005
PLOSONE | www.plosone.org 7 January2013 | Volume 8 | Issue 1 | e55640
ASCsinWoundHealing
(Figure2).WhiletheuseofDFsinwoundrepairhasbeenreported
[31,58],theDFsengraftdidnotenhancegranulationtissueareain
rabbit ear wounds(Figure 3).
Even though ASCs are a promising candidate for cell therapy,
there are several pitfalls to be addressed. First, it is expected that
engrafted ASCs participate in wound repair by either paracrine
signaling or direct differentiation to specific cell types such as
endothelialcellsorkeratinocytes.Therearereportswhichshowed
transdifferentiationofASCsinvivo[26,59].However,itisspeculated
that the major role of engrafted ASCs is secreting cytokines and
growth factors, which enhance wound repair (see the following
paragraph). Multipotency of ASCs has been tested in vitro where
signals are provided to differentiate ASCs to specific cell types;
however, this is unlikely to happen in vivo. Therefore, further
investigation to find the optimum microenvironment for ASCs
differentiationisessentialinthecomplexandmulticellularprocess
of wound repair. Second, allogeneic and xenogeneic therapeutics
have been considered because they have reduced expression of
histocompatibility antigens and secrete immunoregulatory mole-
cules [10,15,16]. However, investigation of immune reaction by
comparing autologous ASCs in quantitative analysis is needed.
Third,alimitingfactorofASCsisthattheydifferinproliferation
and differentiation capacity depending on age, gender, and the
location in the body from which the cells are derived [41,42,43].
Understanding the underlining mechanisms, such as epigenetic
control,isneededfortheclinicaluseofnon-autologousASCs.
Though there are disputes on transdifferentiation of ASCs in
vivo, costaining of engrafted ASCs with other cell types has been
reported in vivo. ASCs are differentiated to endothelial and
epidermal cells in the murine model 2–4 weeks after delivery
[26]. However, costaining of ASCs with endothelial marker was
not found in the rabbit wounds 7 days after delivery (Figure S9).
Therefore,wesuspectthat7daysarenotenoughforrabbitASCs
to be transdifferentiated to other cells or that the microenviron-
Figure 6. Analysis of protein expression in ASCs treated ment in rabbit wounds is different from that in murine wounds.
wounds.Salinecontrol(A,B,C,D)andASCs(E,F,G,H)weredelivered
There are reports which suggest that engrafted ASCs enhance
to wounds and harvested as described in Figure 3. a-SMA (A, E) and
angiogenesisbyreleasingangiogenicfactors[22,60,61,62].Inline
CD3 (B, F) were visualized by DAB after staining with their specific
antibodies.CD31(C,D,G,H)wasstainedwithitsspecificantibodyand withthis,wefoundincreasedCD31positivecellsinwoundbedin
visualizedusingfluorescenceconjugatedsecondaryantibody.(A,B,C, ASCstreatedwounds(Figure6H),thoughdirectdifferentiationof
E,F,G):imagesweretakenfromthearealabeledas‘a’inFigure4.(D, ASCs toendothelial cells was not detected. It has been suggested
H):ImmunostainingforCD31inthearealabeledas‘b’inFigure4.The that MSCs contribute to tissue repair via secretion of soluble
junctionareabetweencartilageandwoundbedswasdemarcatedby
factors rather than transdifferentiation [7,63]. We anticipate that
white dot lines. CD31 positive signals were indicated by arrows in H.
the paracrine effect of ASCs in wound healing is crucial for the
Scalebars:50mm.
doi:10.1371/journal.pone.0055640.g006 healing ofwounds inwhichlargevolume oftissues islost.
Macrophages play key roles during the wound repair process
effect on scar area or elevation index (data not shown). Further whichincludes inflammation, granulation formation, andremod-
investigationisneededtoregenerate,notrepair,tissuewithMSCs eling in wounds [40]. It has been shown that macrophages
promote wound repair after skin injury [64,65,66,67]. Myofibro-
treatment; for example, testing different conditions such as using
blasts are activated fibroblasts and express a-SMA. They play a
matrices as delivery vehicles or initially growing the cells in 3-
critical role in wound repair by depositing extracellular matrices
dimensional cultures which may optimize their properties
such as fibronectin and collagen, and by secreting proteinases
[1,26,45,46].
which remodel the matrix [68]. Thus, both myofibroblasts and
Our results further support the finding suggesting ASCs and
macrophagesarecriticalplayersinwoundrepair.EngraftedASCs
BM-MSCs are not identical, though they have similar surface
showed the myofibroblast phenotype in rabbit ear wound
markers [47,48,49,50]. DFsare poorlycharacterized diverse cells
(Figure 4). In addition, the number of infiltrated macrophages
which locate in dermis. Upon injury DFs are activated and
was increased in ASCs treated wounds (Figure 7). These data
becomemyofibroblasts,whichexpressa-SMAandcytokineswhile
suggest that transplanted ASCs enhance granulation tissue
depositing extracellular matrix [51]. It has been shown that
formation via their activated fibroblast phenotype and increased
human ASCs and DFs display similar surface markers and
recruitment of macrophagesinwounds.
multipotency to differentiate into osteocytes, adipocytes, and
chondrocytes[52,53,54,55].Theyhavesimilarchemokineexpres-
Conclusions
sion profiles. However despite the morphological similarity, they
arenotidentical[56,57].OuranalysisshowedthatDFshaveless
ASCshaveadvantagesascelltherapyagentsascomparedwith
potency to be differentiated compared to ASCs and BM-MSCs
otherMSCs, suchasBM-MSCs.Thisisbecause theyareeasyto
PLOSONE | www.plosone.org 8 January2013 | Volume 8 | Issue 1 | e55640
ASCsinWoundHealing
Figure7.HigherinfiltrationofmacrophageswasfoundinASCstreatedwounds.Salinecontrol(A,C)andASCs(B,D)weredeliveredto
woundsandharvestedasdescribedinFigure3.Neutrophils(A,B)andmacrophages(C,D)werevisualizedbyDABafterstainingwiththeirspecific
antibodies.Scalebars:100mm.(E):Numberofmacrophagesperhigh-powermicroscopicfields(HPF)at400Xmagnification.Macrophageswere
countedandaveragedfromfourHPF.Dataarefromfourindependentwoundsandpresentedasmean+SEM.***p,0.001.
doi:10.1371/journal.pone.0055640.g007
isolatewithrelativeabundance.WeconfirmedthatMSCssurface Figure S2 mRNA level of lineage specific genes was
markers(CD29,CD44,CD90,andCD105)areexpressedinrabbit increasedbydifferentiationinMSCs.DFs,ASCs,andBM-
ASCsandaremaintainedininvitroculture.RabbitASCshavethe MSCs were grown in adipogenic (A), osteogenic (B), or
ability to differentiate into mesodermal cells such as adipocytes, chondrogenic (C) medium for 8, 28, or 21 days. Total RNAs
chondrocytes,andosteocytes.TopicallydeliveredASCsproliferated were isolated and RT-qPCR was performed. Expression of
inthewoundsexhibittheactivatedfibroblastphenotype.Engrafted adiponectin (A), osteopontin (B), and Col10a1 (C) was analyzed.
ASCs increased macrophage recruitment and enhanced granula- Eachgeneexpressionwasnormalizedaccordingtotheexpression
tion tissue formation in wounds. Our data support ASCs as a levelofGapdh.Dataarefromasinglerepresentativeexperiment.
possiblecelltherapycandidatefortherepairofwounds. The level of gene expression in cells cultured in differentiation
medium was compared to cells cultured in non-differentiated
Supporting Information medium,whichwas set at 1.
(PDF)
Figure S1 Western blot analysis for surface markers of
rabbitBM-MSCs.WholecellextractofrabbitBM-MSCsfrom Figure S3 Schematic drawing of rabbit wounds and
P1toP9waspreparedandloaded20mgperwell.Theexpressionof histologicalanalysis.EG,epithelialgap;GA,granulationarea.
CD29,CD44,CD90,andCD105weredetectedwiththeirspecific (PDF)
antibodiesasindicated.b-actinwasdetectedasaloadingcontrol.
(PDF)
PLOSONE | www.plosone.org 9 January2013 | Volume 8 | Issue 1 | e55640