Table Of ContentORIGINALRESEARCH
published:11August2015
doi:10.3389/fmicb.2015.00833
Deep subsurface mine stalactites
trap endemic fissure fluid Archaea,
Bacteria, and Nematoda possibly
originating from ancient seas
GaëtanBorgonie1,2*, BorjaLinage-Alvarez2, AbidemiOjo2, StevenShivambu3,
OlukayodeKuloyo2†, ErrolD.Cason2, SihleMaphanga3, Jan-GVermeulen2,
Editedby: DerekLitthauer2, ColinD.Ralston4, TullisC.Onstott5, BarbaraSherwood-Lollar6 and
MalinBomberg, EstaVanHeerden2
VTTTechnicalResearchCentreof
Finland,Finland 1ExtremeLifeIsyensya,Gentbrugge,Belgium,2DepartmentofBiotechnology,UniversityoftheFreeState,Bloemfontein,
SouthAfrica,3Geology,BeatrixGoldMine,Theunissen,SouthAfrica,4BergvilleRetirementVillage,George,SouthAfrica,
Reviewedby:
5DepartmentofGeosciences,PrincetonUniversity,Princeton,NJ,USA,6DepartmentofEarthSciences,Universityof
LottaPurkamo,
Toronto,Toronto,ON,Canada
VTTTechnicalResearchCentreof
Finland,Finland
CassandraMarnocha, Stalactites (CaCO and salt) from water seeps are frequently encountered in
3
UniversityofDelaware,USA
ceilings of mine tunnels whenever they intersect water-bearing faults or fractures. To
*Correspondence:
determine whether stalactites could be mineralized traps for indigenous fracture water
GaëtanBorgonie,
ExtremeLifeIsyensya,PB65,9050 microorganisms, we analyzedstalactitescollected from three different mines ranging in
Gentbrugge,Belgium depth from 1.3 to 3.1km. During sampling in Beatrix gold mine (1.4km beneath the
[email protected]
surface),centralSouthAfrica,CaCO stalactitesgrowingontheminetunnelceilingwere
†PresentAddress: 3
collectedandobserved,intwocases,tocontainalivingobligatebrackishwater/marine
OlukayodeKuloyo,
DepartmentofGeoscience,University nematodespecies,Monhystrellaparvella.Aftersterilizationoftheoutersurface,mineral
ofCalgary,Calgary,AB,Canada
layerswerephysicallyremovedfromtheoutsidetotheinterior,andDNAextracted.Based
upon16Sand18SrRNAgenesequencing,Archaea,Bacteria,andEukaryaindifferent
Specialtysection:
Thisarticlewassubmittedto combinations were detected for each layer. Using CT scan and electron microscopy
TerrestrialMicrobiology,
the inner structure of CaCO and salt stalactites were analyzed. CaCO stalactites
3 3
asectionofthejournal
FrontiersinMicrobiology show a complex pattern of lamellae carrying bacterially precipitated mineral structures.
Received:30April2015 Nematoda were clearly identified between these layers confirming that bacteria and
Accepted:28July2015 nematodes live inside the stalactites and not only in the central straw. Salt stalactites
Published:11August2015
exhibit a more uniform internal structure. Surprisingly, several Bacteria showing highest
Citation:
sequenceidentitiestomarinespecieswereidentified.This,togetherwiththeobservation
BorgonieG,Linage-AlvarezB,OjoA,
ShivambuS,KuloyoO,CasonED, that the nematode M. parvella recovered from Beatrix gold mine stalactite can only
MaphangaS,VermeulenJ-G, survive in a salty environment makes the origin of the deep subsurface colonization
LitthauerD,RalstonCD,OnstottTC,
enigmatic. The possibility of a Permian origin of fracture fluids is discussed. Our results
Sherwood-LollarBandVanHeerden
E(2015)Deepsubsurfacemine indicate stalactites are suitable for biodiversity recovery and act as natural traps for
stalactitestrapendemicfissurefluid
microorganisms in the fissure water long after the water that formed the stalactite
Archaea,Bacteria,andNematoda
possiblyoriginatingfromancientseas. stoppedflowing.
Front.Microbiol.6:833.
doi:10.3389/fmicb.2015.00833 Keywords:subsurfacesea,stalactites,diversity,Monhystrellaparvella
FrontiersinMicrobiology|www.frontiersin.org 1 August2015|Volume6|Article833
Borgonieetal. Eukaryainsubsurfacestalactites
Introduction intersect water-bearing fractures. Stalactites occur associated
withwater-weepingfracturesintersectedbythetunnel.Sincethe
Studying deep subsurface terrestrial biodiversity can only be presenceofstalactitesintheminesishaphazard,stalactiteswere
achieved through deep drilling and mining or exploration of collected from mines when and where available. Samples were
caverns.Indeepmining,accesstofracturewaterisunpredictable, takenatBeatrixgoldmine,MoabKhotsonggoldmine,Evander
irregular and the volume available for collection may be too goldmineandTauTonagoldmine.
limited.Thelatterisimportantascellcountsofbacteriaindeep
subsurfacefracturewateristypicallylow,requiringlargevolumes BeatrixGoldMine(SibanyeGold,Ltd.)
forderivingsufficientDNAforcharacterizationofthetaxonomic 28◦14(cid:3)24.37(cid:3)(cid:3)S/26◦47(cid:3)49.30(cid:3)(cid:3)E
diversity.Duringdeepminesampling,wehaveencounteredon Beatrix gold mine is located near the towns of Welkom and
severaloccasionsstalactitesonthecorridorortunnelceilings. Virginia, some 240 km southwest of Johannesburg in the Free
In many caverns a large variety of communities comprised StateProvinceofSouthAfrica.Geologicallythemineislocated
ofAlgae,Bacteria,andFungiarefoundembeddedinstalactites along the southern margin of the Witwatersrand Basin. Twelve
and in some cases, these microorganisms have been implicated carbonate stalactites were collected in the same tunnel at two
intheprecipitationofcarbonatesoda-straw(“straws”)stalactites different locations approximately 100–200m apart on level 26
incaves.Thisoccursthroughanumberofprocessesthatinclude of #3 shaft, 1.4 km below the surface. The stalactites were
ammonification,denitrification,sulfatereductionandanaerobic collected in 2009–2010 and 2013. During the 2010 collection
sulfideoxidation(DanielliandEdington,1983;Coxetal.,1989; campaign,fivesoilsamplesweretakenfromthetunnelfloorto
Castanier et al., 1999, 2000; Riding, 2000; Desmarchelier et al., lookfornematodes.ThistunnelislocatedintheWitwatersrand
2006).Thus,undergroundminestalactitesraisedthepossibility Supergroup, which at this location is directly overlain by 400–
that they may act as natural traps for microorganisms in the 800m of Carboniferous Karoo sediments. The age of the
fissurewater.Moreimportantlytheycouldserveasenrichment carbonate stalactites is unknown but cannot be older than 2–3
sites allowing sampling drip waters that defy more traditional yearssincethetunnelwasexcavatedin2007.
samplingmethodsduetothelowwatervolume.Arguingagainst
such an approach is the contamination issue of a stalactite MoabKhotsong,(AnglogoldAshantiLtd.)
hanging free in a strongly ventilated mine corridor where 26◦59(cid:3)14.20(cid:3)(cid:3)S/26◦48(cid:3)5.01(cid:3)(cid:3)E
anthropogenic contamination is a daily possibility. Previous Moab Khotsong is the newest deep-level gold mine in
research on fungal spores in mine air (Pohl et al., 2007) South Africa and is situated near Orkney, Klerksdorp, and
justified this concern and biofilms growing on tunnels walls ViljoenskrooninNorthWestProvince,about180kmsouthwest
below a fissure water outlet from a fracture or a borehole is of Johannesburg. The principal reef is the Vaal Reef of which
generally considered not to be representative of the microbial the gold grade and morphology are considered to be a down-
community with the fracture zone that is supplying the water. dip extension to the south and southeast of Kopanang and
Furthermore,thesmallsizeofthestalactitesandtheenrichment Great Noligwa mines. The reef is comprised of an oligomictic
potential would only allow studying partial biological/chemical conglomerate, where gold is associated with carbon at the
content. base. Stalactite samples some as large as 3m were collected in
Duringroutinesamplingatadepthof−1.4kminBeatrixgold December2012growingontherimofaman-madeventilation
mine,SouthAfrica,severalstalactiteswerecollectedandstoredin shaftatlevel120,whichisatadepthof−3.1km.Theageofthese
Ziplocksamplebags.Uponexaminationwithastereomicroscope stalactitescanbenomorethan5yearsforthesmallestusedfor
we identified a nematode in the fluid that came out of these DNAanalysis,andupto10yearsforthelargestspecimenusedin
stalactites. In the course of the following days, a total of eight theCTscan.
nematodes were observed in the sampling bag. This puzzling
observation led us to examine several stalactites from three EvanderGoldMine(HarmonyGoldMiningCompany
differentminestotestthehypothesisthatstalactitesinminesmay Ltd.)26◦27(cid:3)20.57(cid:3)(cid:3)S/29◦4(cid:3)15.76(cid:3)(cid:3)E
serveasusefulnatural(enrichment)trapsforArchaea,Bacteria, Evandergoldmineissituated8kmnorthwestfromSecundain
and Eukarya. Additionally we wanted to establish the origin of the Mpumalanga Province. The Evander Basin is a tectonically
thenematodesthatoccurredwithinthestalactites,astheyarenot preserved sub-basin outside the main Witwatersrand Basin
knowntobetubebuilderscomparedtootherAnimalia. and forms an asymmetric syncline, plunging north-east. It is
structurally complex with a series of east-north-east striking
Materials and Methods normal faults. At the southeast margin of the basin, vertically
to locally overturned reef is present. The only economic reef
OriginoftheStalactites horizonexploitedintheEvanderBasinistheKimberleyReef.The
TheRepublicofSouthAfricahostssomeoftheworld’sdeepest IntermediateReefisgenerallypoorlymineralized,exceptwhere
mines,someofwhichexceed4kmbelowlandsurface(kmbls). iterodesthesub-croppingKimberleyReeftothesouthandwest
These, deep gold, platinum and diamond mines and their ofthebasin.Severalsmalldriedoutstalactiteswerecollectedin
network of tunnels and crosscuts, allow exceptional access to 2007atshaft#8,level13atadepthof∼1.4km.Oneofthesewas
the deep subsurface. During the course of normal mining keptinaclosedtubefrom2007until2012whenitwasusedfor
operations, the advancing tunnels or exploratory boreholes thepresentanalysis.Theageofthestalactiteisunknown.
FrontiersinMicrobiology|www.frontiersin.org 2 August2015|Volume6|Article833
Borgonieetal. Eukaryainsubsurfacestalactites
TauTonaGoldMine(AngloGoldAshantiLtd.) X-RayDiffraction(XRD)
◦ (cid:3) (cid:3)(cid:3) ◦ (cid:3) (cid:3)(cid:3)
26 2121.29 S/27 2410’12 E Beforemeltingthedifferentstalactitesasmallpiecewasremoved
Tau Tona gold mine is located south of Carletonville in the andhomogenizedfromeachforXRDanalysis.Thesampleswere
GautengProvinceandabout70kmsouthwestofJohannesburg. groundtoagrainsizeof<50μmusingacarbonsteelringand
The sampling site was a nearly horizontal borehole located on agate mortar and pestle. The loose powder samples were then
level118atadepthof3.4kmintheWitwatersrandSupergroup mountedintosteelringsampleholders,andslightlycompressed
andintersectedthePretoriousfaultzone.Theboreholewasnot to give a smooth surface. XRD measurements were performed
sealedandflowedintermittently.Thisboreholewasthesiteofthe using a Panalytical Empyrean X-ray diffractometer, with the
deepestmetazoaneverfoundin2011,amonhysteridnematodeof following con urations: The samples are irradiated with CuKα-
whichonlyaDNAsequencewasknowntodate.Thefissurewater radiation generated at 40mA and 45 kV. No monochromator
◦
wassampledagainin2012–2013inanattempttorecapturethe wasinsertedwhileafixeddivergenceslitof0.2177 waspartof
nematodepreviouslyfoundtherebecauseofitsrelevancetothe incomingbeamoptics.Scanningwascontinuousstartingat5◦2θ
DNAresultsfromtheBeatrixgoldminesubsurfacenematode. andendingat70◦2θ,withstepsize0.0172θfor15.875sperstep.
Measurementswerecarriedoutonastationarysamplewithout
StalactitesUsedforAnalysis
spinning of the sample holder. The identification of minerals
Twelve CaCO3 stalactites were collected in Beatrix gold mine was carried out using Panalytical Highscore software with the
of which two contained a total of 20 nematodes. Of those PDF-2(2009)powderdiffractionfiledatabase,andestimatesof
12 stalactites, two containing nematodes and one devoid of relativeabundancesweremadebasedonsemi-quantitativedata
nematodeswasusedformicro-CTscan,XRDandDNAanalysis. associatedwiththefilesinthisdatabase.
Only one still intact stalactite from Evander mine was used
for XRD and DNA analysis. One small stalactite from Moab DissolvingSaltStalactites/DissectingCarbonate
KhotsongwasusedforXRDanalysis.Oneverylargesaltstalactite Stalactite
from Moab Khotsong was used for macro CT scan and DNA The outer surface of salt/carbonate stalactites was sterilized by
analysis. The different stalactite layers are designated as NSX.Y immersionin100%ethanolandsetalightallowingtheethanolto
where N is thefirstletter of themine from which thestalactite burnoff.Threesmallpiecesweresubsequentlychippedoffand
(S) was collected, X is the number identifying the collection inoculatedontothreedifferentmedianamely,LuriaBertani(LB),
order of the stalactite in a given mine, Y refers to the peeled nutrientagar(NA),andPotatodextroseAgar(PDA)toconfirm
ordissolvedlayerinquestioncountingfromtheoutsidetoward theeffectivenessofsterilization.Theindividuallayerswithinthe
thecenter.Forexample,ES1.4meansthefirstcollectedstalactite stalactiteinthecaseofcarbonatewerecarefullydissectedusing
fromEvandermine,layernumber4. sterilized tweezers; pieces were collected in 1.5mL Eppendorf
tubesforDNAextraction.Forthesaltstalactitessteriledeionized
Micro-CTScan
waterwassprayedonthelayerstodissolvethestalactitecarefully.
Micro-CT is a non-destructive 3D imaging technique for
Cross contamination through dripping from the ends of the
studyingtheinternalstructureofanobject.Setupandconditions
samplewaspreventedbyholdingthestalactitehorizontallyalong
are described in detail in Borgonie et al. (2010). Volume
itslongestaxisandsprayingcarefullyfrombeneath.
renderingandsegmentationwasperformedusingVGStudioMax
(VolumeGraphics).Inanattempttovisualizethenematodes,the
NematodeCulture/HalotoleranceTest
bulk was rendered transparent. Three stalactites were scanned.
Collection and identification of nematodes from fluids that
Oneyieldednematodeswhiletheothertwodidnot.
leached out of the Beatrix gold mine carbonate stalactite
Macro-CTScan was done aseptically. Twelve nematodes were recovered in
the course of 7 days in 2010, and the second stalactite
LargerstalactiteswereCTscannedattheUFSCampusNetcare
collected in 2013 yielded eight nematodes. Culturing was
HospitalusingaGeneralElectricHD750(Milwaukee,USA)with
attempted by placing the nematodes on a 3% salt-agar plate
followingsettings:KvP140,MA450helicalwith0.625mmslices
covered with the saline (14 g/L) water that oozed out of
witha0.312interval.
the stalactite. Halotolerance by the nematodes was performed
ScanningElectronMicroscopy in artificial salt agar. Due to the low number of nematodes
Pieces of stalactite were mounted on a specimen stub and available, the test was performed twice using 12 nematodes
sputter coated with gold using a BIO-RAD (Microscience in total. The initial salt concentration was 14g/L; nematodes
Division) Coating System (London, UK) and observed with were transferred to a different concentration every 24h. The
a Jeol JSM 8440 SEM microscope. For fixation of the nematodes died quickly when the salt concentration was too
◦
CaCO containing nematodes, 70 C 30% formaldehyde was high/low acting as a suitable marker for tolerance. Control
3
used followed longitudinal cutting with a sterile scalpel, then nematodes: Halicephalobus mephisto collected previously from
dehydration, critical point drying, coating and mounting. SEM the same mine but from a borehole (Borgonie et al., 2011) and
pictures were assembled in plates using Adobe Photoshop Poikilolaimus oxycercus a surface collected nematode. For both
(Adobe Systems Inc., San Jose, CA, USA) and where relevant P.oxycercusandH.mephistothirtywormswereusedandwere
coloredusingSmartPhotoeditor(AnthropicsTechnology,Ltd., directlyplacedonagarplateswithdifferentsaltconcentrations.
London,UK). InanattempttoidentifyBacteriausedasfoodbyM.hystrellaone
FrontiersinMicrobiology|www.frontiersin.org 3 August2015|Volume6|Article833
Borgonieetal. Eukaryainsubsurfacestalactites
specimenwasslowlydissolvedina1%NaOClsolutionuntilthe a concentration of 0.2mM for each nucleotide, 0.025 units/μL
outercuticlehaddissolvedasobservedunderastereomicroscope. TaqDNApolymeraseand10ngofextractedDNAtemplatewas
The specimen was then washed three times in deionized water added to each reaction. The thermocycling conditions used for
andDNAextracted. eukaryalandnematodePCRreactionsare:aninitialdenaturation
◦ ◦ ◦
at 94 C for 5min; 35 cycles (94 C for 30 s; 54 C for 30 s;
◦ ◦
DNA Analysis 72 Cfor1min);andafinalextensionat72 Cfor10min(Floyd
et al., 2005) in a PXE 0.2 Thermal Cycler (Thermo Electron
DNAExtraction Corporation).
NucleicAcidExtractionfromtheStalactiteLayers
PCRAmplificationoftheNematodeMitochondrial
CaCO stalactite layers were pulverized in an Eppendorf tube
3 COIGene
using a sterile pestle. The dissolved halite stalactite layers were
Aportionofthemitochondrialcytochromeoxidasecsubunit1
collectedin50mLFalcontubesandthenfilteredusinga0.22μm (cid:4)
(COI)genewasamplifiedwiththeprimersetsCOI1F(5-GGT
filtermembrane(MIS).DNAwasextractedfromthepulverized (cid:4) (cid:4)
CAACAAATCATAAAGATATTGG-3)andCOI1R(5-TAA
CaCO3andfilterusingtheInstaGeneMatrixkit(BIO-RAD732- ACTTCAGGCTGACCAAAAAATCA-3(cid:4))(Valenzuelaetal.,
6030).QualityandconcentrationofDNAwasdeterminedusing (cid:4)
2007);andJB3F(5-TTTTTTGGGCATCCTGAGGTTTAT-
ND-1000Spectrophotometer(NanoDrop). (cid:4) (cid:4) (cid:4)
3)andJB4.5R(5-TAAAGAAAGAACATAATGAAAATG-3)
NucleicAcidExtractionfromNematodes (Deryckeetal.,2005).Amplificationwasconductedfor35cycles,
◦
eachconsistingofa30sdenaturationat94 C,30sannealingat
Nematodes were collected from the petri dish with a sterile
◦ ◦
54 C,and30sextensionat72 C,withaninitialdenaturationstep
platinum needle and transferred into sterile deionized water
◦ ◦
of5minat94 Candafinalextensionstepof10minat72 C.
in a 1.5mL Eppendorf tube. DNA was extracted directly
using the InstaGene Matrix kit (BIO-RAD 732-6030). Quality
DGGEAnalysis
and concentration of DNA was determined using ND-1000
Spectrophotometer(NanoDrop). DGGEAnalysisofPCRProductsofRibosomalDNA
FragmentsfromStalactites
PCRAmplification Theamplified16S/18SrRNAgenefragments(600–800ng)were
PCRAmplificationfromStalactites separatedon7%(w/v)polyacrylamidegelwithaurea/formamide
Fragmentsof16Sand18SrDNAsuitableforDGGEanalysiswere denaturinggradientrangingfrom40to60%.Electrophoresiswas
obtained by using different primer sets for different domains, performed in 1X TAE buffer (40mM Tris, 20mM acetic acid,
◦
(Muyzer et al., 1993; Casamayor et al., 2002; Mühling et al., 1mM EDTA; pH 8.3) at a constant voltage of 100V at 60 C
2008; Stomeo et al., 2012), Bacteria: 27F, 341FGC, 908R, and andrunfor16h.Gelswerestainedfor40minin1XTAEbuffer
1492R;Archaea:934Rand344FGC;Eukarya:516Rand1AFGC. containing Sybr SYBR(cid:5)R Gold Nucleic acid stain (Molecular
The primer sets and the PCR conditions were modified from Probes, Invitrogen) and visualized with UV radiation by using
protocolsdescribedbyCasamayoretal.(2002).Duetothesmall a Gel doc XR and the Quantity one 4.6.7 imaging software
size of the stalactites, an initial PCR was performed using 27F (Bio-Rad).
and 1492R primers followed by nested PCR using 341F with
GC clamp and 908R. PCR conditions for the two steps were: SequencingofDNAFragments
initial denaturation at 94◦C for 3min; 29 cycles (94◦C, for 30 SequencingofStalactitesDNAFragments
◦ ◦ ◦
s;55 Cfor30s;72 Cfor1min);andafinalextensionat72 C DNA was recovered from each excised band reamplified using
for 5min. For the Archaeal 16S rDNA fragments, we used an the same set of primers mentioned above, without the GC
◦
initial denaturation step at 94 C for 2min followed by 30 PCR clamp.ThePCRproductswerethenpurifiedusingExonucleaseI
◦
cycleswithannealingat61 Candafinal10min.extensionstep (ExoI)ThermoScientificFastAPandThermosensitiveAlkaline
◦
at72 C.Theeukaryal18SrDNAfragmentswereamplifiedusing: Phosphatase(#EF0651,Werleetal.,1994).Sequencingreactions
initial denaturation at 94◦C for 130s; 35 cycles (94◦C for 30s; wereperformedwiththeABIPrism™BigDyeterminator™V3.1
◦ ◦ ◦
57 Cfor30s;72 Cfor7min);andafinalextensionat72 Cfor cyclesequencingreadyreactionkitanddatacollectedonanABI
5min. 3130XL genetic analyzer (Applied biosystems). The sequences
were checked for chimeras using Bellerophon (Huber et al.,
PCRAmplificationof18SrRNAGenefrom
2004) and then compared to the GenBank nucleotide database
NematodesinCulture [NationalCenterforBiotechnologyInformation,(NCBI)]using
PCR amplification of 18S rDNA fragments was performed BLAST. Neighbor-joining phylogenetic trees were generated
usingprimersetsEukA[AACCTGGTTGATCCTGCCAGT]and usingreferencesequencesfromtheRDP(Maidaketal.,1997)and
EukB [TGATCCTTCTGCAGGTTCACCTAC] (Diez et al., usingGeneious4.8.5.
2001), and Nem18S(F) [CGCGAATRGCTCATTACAACAGC]
and Nem18S(R) [GGGCGGTATCTGATCGCC] (Floyd et al., SequencingofNematodeDNAFragments
2005). A standard reaction volume was 25μL containing: 1x The amplified DNA fragments were sequenced using the ABI
concentration of Standard Taq buffer (New England BioLab), Prism™BigDye terminator™V3.1 cycle sequencing kit and
(including 1.5mM MgCl ), 0.5μM of each primer, dNTPs at data collected on an ABI 3130XL genetic analyzer (Applied
2
FrontiersinMicrobiology|www.frontiersin.org 4 August2015|Volume6|Article833
Borgonieetal. Eukaryainsubsurfacestalactites
biosystems). The quality of ABI files retrieved using FinchTV Acanthamoeba sp. Castellani, 1930 and a ciliate, Colpoda sp.
software was evaluated and the sequence reads were assembled Müller,1773NonematodeDNAwasidentifiedinthestalactite
using CodonCode Aligner software (CodonCode Corporation, layers(Table1).
Dedham, MA, USA). Overlapping reads or contigs thar Identification of the nematode species that flowed out
represented the consensus regions of DNA were aligned using of the stalactites was done using light microscopy of three
ClustalW (http://www.ebi.ac.uk/Tools/msa/clustalw2/). The adult individuals (Table2). Notwithstanding the limitations in
alignmentwasexaminedforconservedregionssoastoprovide usable specimen (see Materials and Methods) the nematode
sufficient information that reveals any similarity between the species recovered from the two stalactites belong to the genus
twoisolatedorganisms.BLASTNanalysisofDNAdatabasewas MonhystrellaCobb,1918basedonthecephalicsetae,smallbody
used. Sequences were compared to the Nucleotide collection length, and fovea position, presence of a pharyngeal bulbus,
(nr/nt) database and optimized for highly similar sequences a prominent progaster, and vulva at midbody. Measurements
(Megablast). werecomparedwithknownpopulationsfromEthiopia,Namibia
and Bulgaria and confirm the identity as Monhystrella parvella
GenbankSubmissions
(Filipjev,1931;Jacobs,1987)abrackishwater/marinenematode.
All sequences were deposited in Genbank with accession The measurements agree with the Namibian population more
numbers: Bacteria KJ546057-KJ546071, Archaea KJ546072- than the Ethiopian/Bulgarian populations (Table2). An 18S
KJ546075,Eukarya:KJ546076-KJ546081. rRNA gene sequence for M. parvella was obtained but could
not be compared with the Ethiopian, Namibian or Bulgarian
Microscopy
population as no DNA of those samples has been analyzed.
The low number of nematodes available made a tradeoff
Similarity searches using BLASTN algorithm (NCBI database)
necessary between retaining enough specimens to measure
revealed a 91% similarity to the next closest surface nematode
for taxonomic purposes and retaining enough for attempted
Diplolamelloidessp.,whichisamarinenematode.Thisindicates
culturing.Toavoidlosingtoomanynematodestotheattempted
that the Beatrix stalactite nematode species has not yet been
culture only three adult nematodes were used for taking
barcodedonthesurfacetodate.Similaritysearchesalsorevealed
microscopicmeasurements.Thesenematodeswereanesthetized
a96%identitywithapreviouslycollectedsubsurfacenematode
byabriefslideheating.AZeissAxioskopMicroscopewasused. ◦
DNAatTauTonamineinfissurewaterof48 C,salinity14g/L
This approach had the disadvantage that not all small details at−3.4km,230kmtotheNorthofBeatrixgoldmine(Borgonie
could be measured but left enough valid measurements for
et al., 2011). An attempt was made to recapture the Tau Tona
proper identification of the nematode species. These selected
nematode in 2013, which resulted in two nematode specimens
nematodes were returned to the culture but were not used for
being collected. DNA analysis only was hence possible and
thesalttoleranceexperiment.
revealed a 100% match of the 18S rRNA gene sequence and
of the COI mitochondrial gene sequence between Beatrix gold
Results mineM.parvellaandthenewlycollectedTauTonaMonhysterid.
Sequence comparison between the Tau Tona 2011 and 2013
XRD analysis of the carbonate stalactites from Beatrix and sequences confirmed the 96% identity of the 18s rRNA gene
Evander showed its composition to be mixture of calcite sequence.
and aragonite. The XRD analysis of the Moab Khotsong salt OnlythesaltstalactiteofMoabKhotsongcontained16SrRNA
stalactite determined the composition as ∼98% halite + ∼1% genesequencesbelongingtotheEuryarchaeota(Halobacteriales),
sylvite+∼1%quartz. in all 4 dissolved layers (Table1, Figure1). NCBI BLAST
The CaCO stalactites each yielded 3–4 layers when peeled, results of those four sequences showed 99% of identity
3
whereasthesaltstalactitefromMoabKhotsongwasdissolvedin to one uncultured archaeon clone (EV818CFSSAHH131—
fourlayers(Table1).Aftersterilizationnoneoftheouterlayers Halobacteriales)previouslydetectedinacalciticmineralfracture
that were tested on PDA, LB or NA agar showed any growth ofadrillcorecollectedfromEvanderminelevel18of#8shaftat
indicatingthatsterilizationworkedsatisfactorily. adepthof2km(Davidsonetal.,2011).
DNA extraction was successful for all layers and resulted in The bacterial phylogenetic diversity is represented by
archaeal,bacterialand/oreukaryalDNA(Table1).Adifferenceis seven orders (Figure2). Sphingobacteriales, Thermales,
notedbetweensaltandCaCO stalactiteswherethesaltstalactite Burkholderiales, Alteromonadales, Enterobacteriales,
3
show a more uniform yield of archaeal, bacterial or eukaryote Oceanospirillales, Bacillales. The largest represented groups
DNA in all layers of the same stalactite, whereas the CaCO were from the Orders Enterobacteriales, Burkholderiales,
3
stalactitesshowedamorevariablepatternwithnotalllayersof and Oceanospirillales. Significant was the identification of
the same stalactite having the same DNA content. Sequencing most likely marine Bacteria. The Order Oceanospirillales
of extracted DNA was not always successful (Table1). Salt included one sequence that shared the closest identity 92%
stalactitesconsistently yieldeda highernumber DNA bands on to one uncultured bacterium (SGUS738) identified from
DGGE than CaCO stalactites, but yielded poorer sequencing coral fragments taken in Panama. Two additional sequences
3
results(Table1). clearly linked to Gamma-proteobacteria and Alcanivorax sp.
Eukaryal sequences revealed one Fungus (Ordo In the Order Alteromonadales the sequence was closely related
Saccharomycetales Candida sp., Berkh, 1923) and a protozoan, to Bowmanella as well as an uncultured marine bacterium.
FrontiersinMicrobiology|www.frontiersin.org 5 August2015|Volume6|Article833
Borgonieetal. Eukaryainsubsurfacestalactites
TABLE1|Archaeal,Bacterial,andEukaryalDNAresultsfromthestalactiteextractions.
Layer #DGGE DNA(ng/µl)/260/280ratio Closestrelative/Taxonomicposition Acc.number %Identity Source
bands
ARCHAEA/BACTERIA
ES1.1 2 7.43/1.74 Ureibacillus JQ734423 100 Oil-watermixture
ES1.2 1 8.23/1.61 Klebsiella KC907123.1 100 Soil
1 UnculturedCitrobacter GQ416126 100 Biologicaldegreasingsystems
ES1.3 2 5.82/1.54 Pantoea AJ002811 100 Gut
ES1.4 2 5.62/1.80 Thermus AB661716 100 Deepmine,Beatrix
BS2.1 2 147.13/1.70 Bowmanella GQ246642 99 Oceanwater
BS2.2 2 41.02/1.74 Klebsiella HE716897 100 Hostleaves
BS2.3 1 13.45/2.22 UnculturedSGUS738(Oceanospirillales) FJ202645 91 Caribbeancoral
1 Staphylococcussp. EF419336 100 Soil
BS5.1 0 19.99/1.80
BS5.2 1 10.04/1.98 Couldnotbesequenced
BS5.3 0 6.54/1.79
BS6.1 1 13.36/1.57
BS6.2 1 28.25/1.54 Cupriavidus DQ777727 100 Soil
BS6.3 1 16.79/1.85 Cupriavidus DQ777727 100 Soil
MS3.1 1 10.0/2.04 Archaeonclone(Halobacteriales) DQ336966.1 99 DeepmineEvander
3 Alcanivoraxsp. HQ662960 99 Seawater
MS3.2 1 7.74/1.70 Archaeonclone(Halobacteriales) DQ336966.1 99 DeepmineEvander
1 Alcanivoraxsp. HQ662960 100 Seawater
1 UnculturedBacteroidetes JF421218 98 Saline-alkalisoil
MS3.3 1 3.63/1.97 Archaeonclone(Halobacteriales) DQ336966.1 99 DeepmineEvander
1 Pantoeasp. AF394539 100 Grass
MS3.4 1 3.72/1.94 Archaeonclone(Halobacteriales) DQ336966.1 99 DeepmineEvander
Layer #DGGEbands Closestrelative/Taxonomicposition Acc.number %Identity Source
EUKARYA
ES1.1 2 Couldnotbesequenced
ES1.2 3 Acanthamoeba(Protozoa) GQ397466.1 99 Freshwater
1 Candida(Fungi) HM161746.1 92 Humanassociated
ES1.3 2 Unculturedeucarya FN394866.1 92
ES1.4 4 Couldnotbesequenced
BS2.1 2 Couldnotbesequenced
BS2.2 0
BS2.3 2 Couldnotbesequenced
BS5.1 2 Couldnotbesequenced
BS5.2 4 Colpoda(Protozoa) JN251157.1 100 Freshwater
Unculturedeucarya AY905498.1 100
BS5.3 4 Couldnotbesequenced
BS6.1 0
BS6.2 0
BS6.3 1 Couldnotbesequenced
MS3.1 9 Couldnotbesequenced
MS3.2 9 Couldnotbesequenced
MS3.3 4 Couldnotbesequenced
MS3.4 7 Couldnotbesequenced
BS2&5* Monhystrellaparvella(Nematoda) Brackishwater/thermalsprings
NameofthemineisreferredasE(Evander),B(Beatrix),andM(MoabKhotsong).BeatrixstalactiteBS1andBS2containednematodes,BS3didnot.Thelisted260/280ratioisused
toasseespurityoftheextractedDNAusingaNanodrop®spectrophotometer.Avalueof∼1.80isgenerallyacceptedas“pure”forDNA.
*Isolatedbycapturingthefluidflowingoutofthecollectedstalactite.
FrontiersinMicrobiology|www.frontiersin.org 6 August2015|Volume6|Article833
Borgonieetal. Eukaryainsubsurfacestalactites
M.parvellaTABLE2|MeasurementsoffromBeatrixstalactitescomparedwiththepopulationfromEthiopia,Namibia,andBulgaria. Filipjev’sspecimenfromGerlach’sspecimenfromBeatrixgoldminerepublicNamibia1986Ethiopia1926Bulgaria1951ofSouthAfrica2013 Ai-AisNamutoni nsnnsnnMeanMin-maxMeanMin-maxMeanMin-maxMeanMin-maxMeanMin-max .....L11396.0–486.07380.0–460.03401.0–493.010438427–4786472406–50544502684200449662 .....21.0–31.07322.0–33.01015.914.9–17.0617.115–17v.b.w112403317527655 .....76.0–101.07381.0–103.0107972–8369180–99ph.l1288070689913110 .....80.0–117.07388.0–120.01010694–1126112101–120t.l.1196010510121026161 .....224.0–271.073228.0–276.0v11249015822052526240 .....Ph.v.l.11133.0–162.073134.0–164.0148010415161500150 .....v.a.l1182.0–124.07397.0–119.01010693–113611594–12310001099831090111 ....7.6–9.338.0–9.4105.35–665.85.5–6.0h.d1285058607 ....2.2–3.332.5–2.7102.4–2.662.4–2.6f.d.1229032601 ....7.5–11.439.2–10.0a.f.b.l.1292119504 ...c.b.w.1219.0–25.01.7320.0–25.021122625 ....r.l.117.7–13.238.0–11.01010.910–11.5612.611.5–13.51041710343 ....15.0–20.01.7721.0–27.0316.0–21.01027.523.8–29.5627.627.1–28.9a1118224018325 .....4.6–5.475.4–6.834.7–4.9105.55.2–6.065.25.1–5.4b115103614801 .....4.0–5.373.9–4.434.1–4.6104.24.0–4.464.24.0–4.4c114704424403 ....51.0–59.02.0750.0–55.0355.0–56.0V1155952355306 ..G717.0–29.05.11211300 ....n.r.1151–62.0355.0–60.05713657026 .....ph.v.l./ph.l.111.5–1.9731.6–1.717012216401 .....v.a.l./ph.l.110.9–1.3731.1–1.21101141201 .....t.l./ph.l.110.9–1.3731.0–1.21101151101 .....t.l./v.a.l.110.7–1.2731.01001101000 .....C’115.0–7.5135.8–6.759071006305 .....v.a.l./an.b.w.114.6–7.3736.3–6.96107976603 MeasurementsfromEthiopia,Bulgaria,andNamibiawerefromJacobs(1987),Gerlach(1951),andHeynsandCoomans(1989),respectively.A,bodylengthdividedbylargestbodywidth;a.f.b.l.,distancebetweenanteriorbodyendandanteriormarginoffoveaapertures,measuredalongthecentralbodyaxis,an.b.w.,analbodywidth;b,bodylengthdividedbypharynxlength;c,bodylengthdividedbytaillength;C’,taillengthdividedbyanalbodylength;c.b.w.,bodywidthatpharyngo-cardialjunction;f.d.,outerfoveaaperturediametermeasuredparalleltobodyaxis;G,distancebetweenovarium=tipandvulvaaspercentageofbodylength;h.d.,headdiameterbodywidthatthecephalicsetaemeasuredperpendiculartocentralbodyaxis;L,bodylengthmeasuredalongcentralbodyaxis;n,numberofspecimensmeasured;n.r.,distancebetweenanteriorbodyendandnerveringaspercentageofpharynxlength;ph.l.,pharynxlength;ph.v.l.,distancebetweenpharynxandvulva;r.l.,rectumlength;s,standarddeviation;t.l.,taillength;v,distancebetweenanteriorbodyendandvulva;V,distanceofvulvafromanteriorbodyendaspercentageofbodylength;v.a.l.,distancebetweenvulvaandanus;v.b.w.,bodywidthatvulva.
FrontiersinMicrobiology|www.frontiersin.org 7 August2015|Volume6|Article833
Borgonieetal. Eukaryainsubsurfacestalactites
FIGURE1|PhylogenetictreeoftheArchaeaextractedfromthesaltstalactites.
Attempts to culture Archaea and Bacteria from the layered the “amphora” and the “Chinese fan” (Figures3D, 4A–F).
extractsfailedonthreeattempts. Nematodes were identified using SEM between these calcified
layers (Figures5A,B) thereby confirming the nematodes also
CultureTests
live inside the stalactite and not only in the central tube of the
Tosupportthepotentialforamarineoriginforandtodetermine stalactite.
the degree of obligatory salt requirement of M. parvella we Macro CT scan of the salt stalactites showed no organized
tested the culture in a salt gradient. The salt tolerance test internal structure was evident as in the CaCO stalactites. To
3
clearly showed a salinity requirement range of 9–14g/L for M. ascertainthatthiswasnotduetoresolutionproblemsaCTscan
parvella whereas the control species clearly showed very little of a large salt stalactite from the same sampling site at Moab
toleranceforanysalt(Table3).M.parvellawasdifficulttokeep Khotsong(23cmlength,largestwidth8.5cmweight2.0kg)was
inculturesincethenematodeswerenotproducingoffspringand scannedunderahospitalCT-scanner(Videos2,3).Thescansdid
becoming immobile. In an attempt to halt the decline of the notrevealanorganizedinternalstructurebutarandomsponge-
cultureanattemptwasmadetoidentifytheBacteriaassociated likestructurepunctuatedbyaconsiderablenumberofair/water
with the nematodes. One nematode specimen from the culture vacuoles(Videos2,3).
was sacrificed and DNA sequencing identified the presence
of Alicyclobacillus sp. (99% identity). This is a spore-forming,
aerobicsulfurandferrousironoxidizer(Firmicutes)(Wisotzkey Discussion
etal.,1992).Subsequentadditionofsulfate(1mMMgSO final
4
concentration)tothenematodecultureledtoamarkedrebound Usingethanol-flamesterilizedstalactites,extractionofarchaeal,
of nematode activity however the effect could not be sustained bacterialandeukaryoticDNAfromsaltandCaCO3stalactitesis
andthenematodeculturediedouteventually. possible.Salthasbeenshowntobeaveryeffectivepreservative
forDNA(Frantzenetal.,1998)andprobablyexplainsthehigher
CTScanning diversity yield in salt stalactites. Because the CaCO stalactites
3
Micro CT scanning and SEM of the CaCO stalactites that were dry at the moment of sterilization it may explain the
3
yieldednematodesfailedtorevealanyaperturesintheoutermost less consistent and lower yield which probably originates from
CaCO layer. Micro CT scanning revealed a circular layered organisms in survival stages hence yielding more sequenceable
3
internal stalactite structure, laminae, with cavities between the DNA. The drying out would explain the absence of nematode
layersthemselvespopulatedwithseveraltypeofdifferentshaped DNAasM.parvelladoesnothaveasurvivalstage.
outgrowths mainly, although not always, pointed toward the Eumetazoa have been reported inhabiting stalactite like
center (Figures3A–C, Video1). All CaCO stalactites scanned structures (so called biostalactites) (Sanfilippo et al., 2014).
3
showed turning laminae more numerous closer to the ceiling But these biostalactites consist of crusts produced by (among
than at the bottom. Using CT scan the highest number others) the Eumetazoa themselves. Generally these are a few
of laminae counted was 16 layers of partial or complete centimeters thick and consist of small serpulids and other
laminae in the stalactite part near the ceiling, diminishing to a Eumetazoa.Thelargeronesoftenincludeanucleusofserpulid
minimumof8neartheexitofthestraw.Fourmorphologically tubes. The metazoans include mainly serpuloideans, sponges,
different outgrowths were identified; the “coralloid,” the “pine,” bryozoansandforaminifers(Sanfilippoetal.,2014).Nematodes
FrontiersinMicrobiology|www.frontiersin.org 8 August2015|Volume6|Article833
Borgonieetal. Eukaryainsubsurfacestalactites
TABLE3|Saltrequirementexperiment.
Saltg/l 0 2 3 5 8 9 10 14 15 16
Poikilolaimusoxycercus + + – – – – – – – –
Monhystrellaparvella – – – – – + + + – –
Halicephalobusmephisto + + + – – – – – – –
Poiukilolaimusoxycercusisanematodefromthesurface,Halicephalobusmephistoa
deepsubsurfacecollectedspecies.Allarebacteriophagousnematodes.
have never been reported living inside stalactites before.
Additionally nematodes are not tube building Eumetazoa like
e.g., some Annelida. The discovery cannot be compared to
the aforementioned biostalactites as it concerns Eumetazoa
effectively “trapped” and surviving inside a solid stalactite. The
nematodes themselves do not excrete stalactite material or
otherwisecontributedirectlytothestalactiteformation.
PuzzlingfindingswereoneArchaeaandtwostalactiteBacteria
withahighidentitytomarinespecies.MS1.1–1.4allcontaineda
specieswithclosestidentitytoHalobacteriales.Theseorganisms
are the dominant taxa in hypersaline ecosystems, such as
salterns, salt and soda lakes and coastal areas, in which NaCl
concentrations can reach 150–350 g/L (Andam et al., 2012).
However, Halobacteriales strains from ecosystems with low
salinities(1–3.5%NaCl)havebeenreported,wheretheyappear
to possess exceptional survival capabilities and/or are capable
of exploiting niches of relatively higher salinities created due
totemporalandspatialvariationsingeochemicalconditionsin
such ecosystems (Youssef et al., 2012). BS2.1 closest identity
to Bowmanella sp. is only known from marine habitats. BS2.3
was identified as an uncultured bacterium showing highest
similarity again to the marine group Oceanospirillales. MS3.1
shared closest identity to Alcanivorax sp. also of marine origin
(Yakimovetal.,1998).AlthoughtheDNAresultsoftheBacteria
are not extensive enough to state as a certainty that these are
marineBacteria,thediscoveryofM.parvellathatcannotsurvive
outside a salty environment however does point strongly to a
marinefingerprint.SincenoneoftheBacteriafromthestalactites
couldbeculturedtheevidencerestsonthenematode.Although
M. parvella resulting from human contamination is difficult to
fathom for an organism that requires a salty environment, it
is essential to establish that M. parvella is indigenous to the
stalactite as a result of fissure water. Three major questions
are important to determine whether the nematode M. parvella
recoveredisindigenoustothecarbonatestalactite:(1)arethere
aperturesinthestalactitethatwouldexplainentryinthestalactite
bynematodesotherthanthefissurewater?,(2)Isthereevidence
of bacterial growth serving as a food source for the nematode
insidethestalactites?,(3)Thehighsalttoleranceofthenematode
speciesmightsupportindigenousorigin,buttowhatextentisthe
salttoleranceofthenematodespeciesrestrictive?
AperturesOtherthantheSodaStrawinthe
CarbonateStalactites
FIGURE2|PhylogenetictreeoftheBacteriaextractedfromthesalt Analternativewayofnematodeentrywouldbethatanematode
stalactites.
eitherfromtheminetunnelorflowingoutofafissureandinto
FrontiersinMicrobiology|www.frontiersin.org 9 August2015|Volume6|Article833
Borgonieetal. Eukaryainsubsurfacestalactites
FscIGanUoRfEC3aC|OM3icsrtoalaCcTtitsectahnatocfoCntaaCinOed3nsetamlaactotidtees..(ATh)eGaerneearaslhhoawbnituissnoefaCrT FtoIGFUigRuEre43|ASbEuMtnoofnt-hlineeCaralyCcOo3msptaaclatecdtiates.it(Ao)nGlyesneervraelsbtuoilth.igImhlaigghetitdheentical
thetipofthesodastrawatthebottomofthestalactiteawayfromtheceiling.
positionofimage(B).(B)Detailoftheouter,smoothsurfaceofthestalactite
Thebentlaminaeareclearlyvisibleasistheknoblikeoutgrowthsonthem.
showingthemuchcoarserbuiltofthemoreinteriorlayersinside.Low
Cotton(C)wasusedtostabilizethestalactiteforscanning.(B)Longitudinal
resolutionofanareacoveredintheshrubcalled“pineforest.”(C–F)The
sectioninsidethelowerpartofimage(A).Thelamellarbuiltofthestalactite
andtheoutgrowthsareplainlyvisible.(C,D)Crosssectionsofthestalactitein differenttypesofshrubsidentifiedintheCaCO3stalactite.(C)The
“cauliflower”themostdominantlypresent.(D)The“Chinesefan”(darkblue)
anareaclosetotheceiling(C)andneartheend(D).Outgrowthscanbecome
(E)the“pineforest”(lightblue).(F)The“amphora”(blue).Nologicalpatternof
verydominantandthelaminaecanformcompleteorpartiallyenclosedspaces
presencecouldbededucedforanyoftheseshrubs.Scalebars(B)and(F):
(*)withintheinnerstalactite.Scalebars:(A)4cm,(B):0.1cm,(C):7cm,(D):
100μm,(C–E):10μm.
5cm.
theminetunnelfloorcrawlsallthewayupthewall,ontheceiling BacteriaGrowthinsideCarbonateStalactites
whereithastowithstandthewaterflowformingthestalactiteand If, as we contend, the nematodes become trapped inside the
crawlintothestalactite.(Micro)-CTscanandSEMdidnotreveal stalactitewiththewaterthatformsthestalactite,thenematodes
any apertures in the carbonate stalactites that could explain an can only survive if they have a ready supply of bacterial food
alternativepathwayofentryforthenematodesthantransportvia inside the stalactite. Although a number of Bacteria have been
the fissure water that built the stalactite. Although the absence identifiedinthestalactitelayersthepresenceofBacteriainitself
of apertures does not rule out the gradual “incorporation” of does not constitute evidence that these Bacteria are available
thenematodesasthestalactitegrowsandnematodescrawltheir as a food source for the nematodes. SEM was used to identify
way up and move against the water drip into the soda straw. structures that are bacterially induced and support Bacteria
Using the Andrassy formula (Andrassy, 1956) and a density of were effectively growing inside the CaCO stalactites. We had
3
1.13g cm−3, the estimated dry weight mass of M. parvella is therefore,wehadtorelyonsecondarystructuresindicatingthe
2.03×10−8g,whichmakesithighlyunlikelyitwouldbeableto presenceofBacteriatheso-calledbacterialdeposited“shrubs”as
moveagainstthewaterdripontheceiling.Nonematodeswere described and experimentally grown and proven to be Bacteria
foundimmediatelybeneathorinthevicinityofthestalactitedrip inducedbySánchez-Navasetal.(2013).TheSEMrevealed,based
on the second stalactite collection trip in 2010 or anywhere in on their morphology, four types of shrubs of which one was
the tunnel thus weakening the alternative theory of nematodes very similar to the experimentally induced ones (Figure 14 in
crawlingupthewallbutsupportinganindigenousoriginofthe Sánchez-Navasetal.,2013).Sincewebasedthetypesofshrubson
nematodes. morphologyandcannotlinkaspecifictypeofshrubtoaspecific
FrontiersinMicrobiology|www.frontiersin.org 10 August2015|Volume6|Article833
Description:Nematoda were clearly identified between these layers confirming that bacteria .. of a drill core collected from Evander mine level 18 of #8 shaft at.