Physiologic and metabolic characterization of a new marine isolate (BM39) of Pantoea sp. producing high levels of exopolysaccharide.

1.4 MB·English

by  Silvi, Silvia

Physiologic and metabolic characterization of a
new marine isolate (BM39) of Pantoea sp.
producing high levels of exopolysaccharide
Silvi et al.
Silvietal.MicrobialCellFactories2013,12:10
http://www.microbialcellfactories.com/content/12/1/10
Silvietal.MicrobialCellFactories2013,12:10
http://www.microbialcellfactories.com/content/12/1/10
RESEARCH Open Access
Physiologic and metabolic characterization of a
new marine isolate (BM39) of Pantoea sp.
producing high levels of exopolysaccharide
Silvia Silvi1, Paolo Barghini1, Arianna Aquilanti1, Belen Juarez-Jimenez2 and Massimiliano Fenice1,3*
Abstract
Background: Marine environments are the widest fonts ofbiodiversity representing a resource of both unexploited
or unknown microorganisms and new substanceshaving potentialapplications. Among microbialproducts,
exopolysaccharides (EPS) have many physiological functions and practical applications. Since EPS production by
many bacteriais tooscarce for practical use and only few species are known for their high levels ofproduction,the
search of new high EPS producers is of paramount importance. Many marine bacteria, that produce EPS to cope
withstrong environmental stress, could be potentiallyexploited atthe industrial level.
Results: A novel bacterium, strain BM39, previously isolated from sediments collected inthe Tyrrhenian Sea, was
selected for itsproduction ofvery high levels ofEPS.BM39 was affiliated to Pantoea sp. (Enterobacteriaceae) by16S
rRNA gene sequencing and biochemical tests. According to thephylogenetic tree, this strain, being quite far from
theclosest known Pantoeaspecies(96% identity with P. agglomeransand P. ananatis) could belong to a new
species. EPS production was fast (maximum of ca. 21 g/L in 24 h onglucose medium) and mainly obtained during
theexponential growth. Preliminary characterization,carried out by thin layer and gel filtration chromatography,
showed that the EPS, being a glucose homopolymer withMW of ca.830 kDa, appeared to be different from those
ofother bacteriaof same genus.The bacterium showed a typical slightly halophilic behavior growing optimally at
NaCl 40‰ (growing range 0-100‰). Flow cytometry studies indicated thatgood cell survival was maintained for
24 hat 120‰.Survival decreased dramatically with theincreaseof salinity being only 1 hat 280‰. The
biochemical characterization,carried out with the Biolog system, showed that MB39 had a rather limited metabolic
capacity. Itsability, rather lower than that ofP. agglomerans,was almost onlyconfined to the metabolization of
simple sugars and theirderivatives. Few alcohols, organic acids and nitrogen compounds were partially used too.
Conclusions: Strain BM39, probably belonging to a new species, due to its remarkable EPS production,comparable
to those ofknown industrial bacterial producers, could be suggested as a new microorganism for industrial
applications.
Keywords: Pantoea sp.,Halophilic bacterium, Flow cytometry, Biolog, Exopolysaccharide production
*Correspondence:[email protected]
1DipartimentodiScienzeEcologicheeBiologicheandLaboratoriodi
MicrobiologiaMarinaApplicata,CONISMA(ConsorzioInteruniversitario
ScienzedelMare),UniversityofTuscia,Viterbo01100,Italy
3LaboratoriodiMicrobiologiaMarinaApplicata,CONISMA(Consorzio
InteruniversitarioScienzedelMare),UniversityofTuscia,Viterbo01100,Italy
Fulllistofauthorinformationisavailableattheendofthearticle
©2013Silvietal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative
CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and
reproductioninanymedium,providedtheoriginalworkisproperlycited.
Silvietal.MicrobialCellFactories2013,12:10 Page2of11
http://www.microbialcellfactories.com/content/12/1/10
Background In this study, we report on the detailed metabolic
Oceans and seas are the widest sources of biological and characterizationofanewslighthalophilicmarinebacter-
chemical diversity representing a prolific reserve of un- ium producing high levels of exopolysaccharide. The
exploited and/or unknown microorganisms [1,2]. Thus, strain was identified as Pantoea sp. by 16S rRNA gene
marine environments are great resources of new sub- sequencing and biochemical tests. Time course of EPS
stances having potential applications in pharmaceutical, production and partial chemical characterization of the
feed and food, fine chemicals and enzyme industries polymer are also reported. In addition, physiologic adap-
[2,3]. The search of new microorganisms, having unique tation tosalinityisalsostudiedbybothculturalmethods
physiological and metabolic capabilities, aids to better andflow cytometry.
comprehend the ecosystem and provides opportunities
to discover new compounds of commercial importance. Results and discussion
This is particularly true for marine bacteria that have Strainidentification
been less studied than their terrestrial counterpart and The isolate, subjected to 16S rDNA sequence analysis
are often underrated or completely ignored by many (1266bp),wasaffiliatedtothegenusPantoea.Itssequence,
scientists[4,5]. GeneBank accession number “BankIt1581807 Pantoea
Among the microbial products, exopolysaccharides KC163803”, matched with entries with similarities ranging
(EPS) have many important physiological functions and from96to98%.However,matchingwithknownspeciesof
various practical applications deductible from their roles Pantoea was 96% only; thus, due to the low similarity,
innature. BM39assignmenttothespecieslevelwasnotpossible.
These high molecular weight polymers represent es- In addition, considering the broad phylogenetic dis-
sential components of the secreted extracellular material tance from the most similar Pantoea species, the strain
and are involved in various cell function such as: cell could belong to a new species. Figure 1 reports the
protection from freezing, dehydration and antimicrobial phylogenetic relationships, based on alignments with the
agents [6-9]; adhesion to surfaces, other organisms and most similar sequences of 16S Pantoea species, as
biofilm production [10]; support in pathogeny and viru- obtained by comparison with Blastn analysis. Due to
lence [11,12]; inhibition of biofilm formation [13,14]; evident inaccurate species attribution, some sequences
storage ofreserve carbon sources[10]. havenotbeenincluded inthe dendrogram;the outgroup
EPS find applications in environmental biotechnology constituted by E. coli was added according to literature
beingemployedinsoilandwaterbioremediation,decon- [35-37]. The phylogenetic analysis showed that BM39
tamination and detoxification [15-18]. Moreover, they constituted an external cluster quite far from the most
are used in pharmaceutical/biomedical [19,20], cosmetic similar species, P. ananatis and P. agglomerans, orga-
[21],chemical[22,23]andfood industries [24,25]. nized in two separate groups. Within the P. agglomerans
The amount of EPS produced by many bacteria, few group there was a further cluster of P. conspicua, and P.
grams per liter, is too low for their practical use. By con- vagans (Figure 1).
trast, only few species are known for their high levels of
production. Among them, strains of Xanthomonas cam-
pestris, Bacillus polymyxa, Klebsiella pneumonie and
Sfingomonas elodea are the most studied and only few
areusedattheindustriallevel[16,26-29].
Different microorganisms produce EPS with diverse
composition and having different characteristics lead-
ing to their employment in diversified ambits [12,16].
In addition, same microorganism could release EPS
with different composition when grown in different
conditions [17]. In this context, the search of new high
EPS producers is still important to find new applica-
tions or better fit traditional uses. Moreover, strain
physiologic and metabolic characterization is extremely
useful to understand and optimize microbial produc-
tions [30,31]. Figure1PhylogenetictreeofPantoeaspeciesbasedon16S
In marine environment many bacteria, producing EPS rDNAsequences.Thetree,basedon14sequencesand1300
to cope with strong environmental stress and to survive positions,hasbeengeneratedusingneighbor-joiningalgorithmand
maximumcompositelikelihoodmodelandcalculatedusingMega4
adverse conditions [32-34], represent promising sources
program.Bootstrapvaluesfrom1000pseudo-replicatesareshown.
ofspeciestobeexploitedatthe industrial level.
Silvietal.MicrobialCellFactories2013,12:10 Page3of11
http://www.microbialcellfactories.com/content/12/1/10
The uncertain affiliation of BM39 was observed by the significant in relation to the time necessary to reach
Biolog system too. The information obtained did not maximal growth (Figure 2). Starting from 70‰, signifi-
consent the attribution to species included in the data- cant differences were recorded for maximal growth also.
base being P. agglomerans, the closest species with 51% BM39 grew up to 100‰ but above 80‰ growth was
ofsimilarity only. verylimitedandstronglydelayed (Figure 2).
The microorganism, thus defined as slight halophilic,
Metaboliccharacterization appears well adapted to a rather broad range of salinity
Preliminary tests showed that strain BM39, as generally but growth far from optimal conditions required more
reported for Pantoea [35,36,38,39] is a mobile, gram time probably for more complexhomeostasisregulation.
negative, catalase positive and oxidase negative rod More detailed information concerning homeostasis
(0.42±0.15 – 2.87±1.0 μm). and physiological state of each bacterial cell, submitted
to different conditions of salinity, had been obtained by
Growthandphysiologicalstateatdifferentsalinities flowcytometry inthe range0-280‰.
Traditionally, strict definition of “marine microorgan- Figure 3 reports the physiological state of BM39 cells,
ism”impliesthatamarinespecies mustbefoundonlyin at different salinities and incubation times, in terms of
marine environments [40,41]. Even if many species are membrane polarization and ratio between live and dead
just confined inmarine environments,others,widelydif- cells as determined by the differential staining with
fused interrestrial environments,present strains that are DiOC6 and PI, respectively. At 0 h, the bacterium
well adapted to marine conditions [30]. Thus, it is diffi- physiological state is quite similar for all the tested NaCl
cult to understand if a microorganism, isolated from sea concentrations (Figure 3a-f). Some cells, with low mem-
samples could be defined as “marine”. Actually, the iso- brane polarization, could be considered still in a latent
late could be a strict marine microorganism, an adapted state (scarce DiOC6 and no PI), while the majority,
strain from other environments or a microorganism showing well polarized membranes, presented active and
accidentally found still alive in the sea but non-adapted stable physiological conditions (strong DiOC6). Only
tomarine conditions. few dying cells were recorded particularly in samples at
Sea salinityinBM39samplingareaisaround38‰allthe highersalinity (scarcePI).Itisexpectedthatcells,grown
year[42,43]andwasmeasuredat37.8‰ duringsampling. in favorable conditions of nutrients and chemico-
Pantoea sp. BM39, tested at different salinities ranging physical parameters, pass from latencyto the active state
from 0 to 120‰, grew optimally at NaCl 40‰ stating at starting their metabolic activities. This situation, evi-
least its adaptation to marine environment. However, no denced bystaining with DiOC6only,persistsuntilfavor-
statistical differences were recorded for maximal growth able conditions are maintained. If favorable conditions
in the range 0-60‰. By contrast, differences were are not established or in case of nutrients depletion,
Figure2TimecourseofgrowthofPantoeasp.BM39cultivatedfor36honLBcontainingdifferentconcentration,0-120‰ step10‰,
ofNaClmeasuredspectrofotometrically(OD ).TablelegendreportsOD andthetimeofmaximalgrowthatthevariousconcentrationsof
600 600
NaCl.Datafollowedbysamesuperscriptletterarenotsignificantlydifferent(P<0.05)bytheTukeytest.Legendtablereports:Sal=Salinity;MG=
maximumgrowthandTM=timetoreachmaximumgrowth.Valuesinsamecolumnfollowedbyatleastoneidenticalsuperscriptlettersarenot
significantlydifferentbytheTukeytest(P<0.01).
Silvietal.MicrobialCellFactories2013,12:10 Page4of11
http://www.microbialcellfactories.com/content/12/1/10
Figure3FlowcytometryofBM39grownfor72honLBcontainingdifferentconcentrationsofNaCl,0‰(a),40‰(b)80‰
(c),120‰(d),200‰(e)and280‰(f),andstainedwithDiOC6andPI.Onlymoresignificantsamplesareshown.Greenspots=DiOC6
positivecellsshowinghighmembranepolarization;Lightbluespots=DiOC6andPInegativeshowingcellsinlatency;Darkbluespots=DiOC6
positiveandPIpositiveshowingcellsstartingtoloosemembranepolarizationandtoacquirePI;Redspots=PIpositiveshowingdeadcells.
Silvietal.MicrobialCellFactories2013,12:10 Page5of11
http://www.microbialcellfactories.com/content/12/1/10
viable cells pass to the latent state, loosing membrane time course of the various fractions of BM39 cell popu-
polarization, before starting to die. Such cells lose lations showing different physiological states (latency,
DiOC6 and start to assume PI while dead cells are active viability, dying and dead) in two opposite condi-
strongly PI stained only. All these physiological condi- tions of salinity, 40 (optimal) and 280‰ (worst). At
tions and the transition among the various situations 40‰, almost all the cell, after a short period of latency,
were wellevidenced for BM39inFigure3. showed high viability till nutrients were available (48 h);
In this context, remarkable differences were recorded, starvation started thereafter (Figure 4a). By contrast, at
during the experiment progression, in relation to salin- 280‰ intense cell sufferance was recorded already after
ity. As expected, optimal conditions were confirmed at 1 h and cells started to exponentially die thereafter
40‰. In fact, this is the sole situation showing all cells (Figure 4b).
in complete viable state (strong DiOC6, only) after 24 h
of incubation. Cells started to die, for possible initial Metabolismofdifferentcarbonsources
starvation, around the 48 h to be in advanced dead Themetabolicabilitiesof BM39, in relation to the use of
phaseat 72h(Figure3b). 95 carbon sources, were tested by the Biolog system.
Similarbehaviorwasrecordedbothat0and80‰even The strain showed a rather limited metabolic compe-
if signs of cell sufferance were more evident at 48 h, in tence being able to use only 24 compounds (Table 1).
particular at 80‰ (Figure 3a, c). The progressive in- Among them, the majority were simple sugars or deriva-
crease of salinity proportionally determined the increase tives. Some organic and amino acids and few other
of cell sufferance. This is particularly evident at 280‰; nitrogen compounds were metabolized too. Even with
in this case, after only 2 h, almost all cells were died or diversified competence, similar low metabolic capacity
dying(Figure 3f). was recorded for P. vagans [35], while P. agglomerans
Same situation was recorded using a different combin- showed wider aptitude (Biolog database). A limited
ation of fluorescent dyes (FDA+PI). Figure 4 reports the metabolic competence indicates a rather specialized
strain with low eco-versatility as reported for other
microorganisms [3,30,44]. Comparison, between BM39
and other Pantoea species, in relation to the metabolic
abilities, is not easy due to the scarce information avail-
able and to the different methodologies used. However,
we compared the use of 50 carbon sources with data
obtained in literature [35,37,45]. Figure 5 reports a den-
drogram showing the metabolic relationships between
BM39 and other Pantoea species. Our strain, that
appeared equidistant from P. agglomerans and P. anana-
tis under the phylogenetic point of view (Figure 1), was
found much more similar to P. agglomeransat the meta-
bolic level being in the same cluster. This could be
explained by the great metabolic diversity within the
genus Pantoea[36,45].
ProductionofEPSandpartialpolymercharacterization
Growth and EPS production by BM39 was tested using
rather common carbon sources (sucrose, glucose and
fructose) at a quite high concentration to induce high
production (Figure 6) [8,26,28]. As for the bacterial bio-
mass, there was no statistical difference among the vari-
ous media. Maximal EPS production (21.30±2.03 g/L)
was obtained on glucose (EMG) after 18h ofincubation.
Figure4TimecourseofcellpopulationsfractionsofPantoea
On both sucrose and fructose EPS release was definitely
sp.BM39,grownfor72honLBcontaining40‰(a)and280‰
lower and delayed, being 11.82±1.06 and 11.05±1.17 g/L
(b)ofNaClandstainedwithFDAandPI,asrevealedbyflow
cytometry.Greenline=FDApositivecellsshowinghighviability; at 30 h, respectively. All other kinetic parameters, such
Lightblueline=FDAandPInegativeshowingcellsinlatency;Dark asyieldandproductivity,werehighestonEMG(Table2).
blueline=FDApositiveandPIpositiveshowingcellsstartingto The superior yield recorded in EMG means that in this
looseviabilityandtoacquirePI;Redline=PIpositiveshowing
medium the bacterium was able to better convert the
deadcells.
substrate into EPS (Y ) and the biomass was more
P/S
Silvietal.MicrobialCellFactories2013,12:10 Page6of11
http://www.microbialcellfactories.com/content/12/1/10
Table1ComparisonbetweenthemetaboliccompetencesofPantoeasp.BM39andotherPantoeaspeciesasrevealed
bytheBiologsystem
Carbonsource BM39 Pa Pv
α-Cyclodextrin,dextrin,glycogen,N-Acetyl-D-galactosamine,adonitol,i-erythritol,L-fucose,lactulose,D-raffinose,D-sorbitol,xylitol - - -
N-acetyl-D-glucosamine,L-arabinose,D-fructose,D-galactose,α-D-glucose,maltose,D-mannitol,D-mannose,sucrose,D-trehalose, + + +
D-arabitol,D-psicose,turanose - + -
D-cellobiose,gentiobiose - - +
m-inositol + - +
α-D-lactose,D-melibiose,β-A-26-methyl-D-glucoside + + -
L-rhamnose - + +
Succinicac.methyl-ester,aceticac.,formicac.,D-galactonicac.Lactone,D-glucosaminicac.,α-OH-butyricac.,β-OH-butyricac.,γ-OH- - - -
butyricac.,p-OH-phenylaceticac.,itaconicac.,α-ketobutyricac.,α-ketoglutaricac.,α-ketovalericac.,propionicac.,quinicac.,
D-saccharicac.,sebacicac.,bromosuccinicac.,succinamicac.,glucuronamide
Pyruvicac.methylester,D-gluconicac.,D,L-lacticac. + + -
Cis-aconiticac.,D-glucuronicac.,D-galacturonicac. - + -
Citricac.,succinicac. - + +
Malonicac. - - +
L-alaninamide,L-alanylglycine,L-asparagine,glycyl-L-asparticac.,glycyl-L-glutamicac.,L-histidine,OH-L-proline,L-leucine,L-ornithine, - - -
L-phenylalanine,L-pyroglutamicac.,L-threonine,D,L-carnitine,γ-aminobutyricac.,urocanicac.,
L-glutamicAc. + + +
D-alanine,L-alanine,L-asparticac.,L-proline,D-serine - - +
L-serine - + -
Phenyethylamine,putrescine,2-aminoethanol,2,3-butanediol - - -
Glycerol + + +
Tween40 - - +
Tween80 - - +
Inosine,uridine,thymidine + + -
D,L-α-glycerolphosphate - + -
α-D-glucose-1-phosphate,D-glucose-6-phosphate + + -
Legend:Pa=P.agglomerans(Biologdatabase);Pv=P.vagans(Bradyetal.,2009).
efficient (Y ). In other words, a lower amount of bio- improved by accurate medium formulation and culture
P/X
mass contributed to higher EPS production. The highest conditionoptimization[31,46-49].Ourstrainproduction
productivity in EMG is particularly interesting in view of could be considered quite good also in relation to other
possible applicationattheindustrialscale. already studied bacteria. Various known producers re-
Since medium has not been optimized yet and process lease just few g/L of EPS and rarely exceed the amount
had been carried out in shaken flasks, the EPS produc- of 10 g/L [26,27,29,50-52]. Few others, produce much
tion by BM39 could be considered already very high. It higher levels of EPS comparable with those of BM39 or
is worth noting that, as reported for many other even higher. However, the high production was often
processes, microbial productions could be strongly obtained after optimization to increase strain perform-
ance [28,53]. For example, P. agglomerans (Enterobacter
agglomerans) strain CRDA 312 produced 27.5 g/L of
EPS [53] but the production was achieved in stirred bior-
eactorsthatgenerallyconsentbetterperformancesinrela-
tiontosameprocesscarriedoutinshakenflasks[31].
Preliminary EPS characterization, carried out by thin
layer chromatography after acid hydrolysis, showed that
Figure5DendrogramofmetabolicsimilaritiesamongPantoea the polymer was constituted only by monomeric units of
sp.BM39andotherPantoeaspeciesgeneratedusingneighbor- glucose (data not shown). This justifies the better per-
joiningalgorithmandcalculatedusingMega4program.
formance of EMG in comparison with the other media
Similarityhasbeencalculatedbasedon50differentcarbonsources.
tested. Very likely, glucose is directly used to assemble
Silvietal.MicrobialCellFactories2013,12:10 Page7of11
http://www.microbialcellfactories.com/content/12/1/10
Figure6TimecourseofEPSproductionbyPantoeasp.BM39grownonEMF(blackline),EMG(redline)andEMS(blueline)for48hin
shakenculturesat28°Cand180rpm.
the biopolymer while fructose and sucrose need a bio- different from those of other bacteria, could have differ-
conversion before EPS formation. Apparent molecular ent applications. EPS production is comparable with
weight of the polymer, determined by gel permeation those of known industrial strains and, taking into ac-
chromatography,was830kDa. count that the process has not been optimized yet,
It is worth noting, that other known species of Pantoea BM39 could be considered very promising for the ex-
produce EPS with different composition and characteris- ploitationattheindustriallevel.
tics.Forexample,P.stewartiiisnotetoproduce“stewartan”
aheteropolymerofglucoseandgalactose[54].P.agglomer-
Methods
ans KFS-9 produces a heteropolymer constituted by ara-
Chemicals
binose, glucose galactose and gulcuronic acid with a
Plate Count Agar (PCA), Yeast extract (YE); Bacto-
molecular weight of 760 kDa [55]. However, BM39 pro-
Tryptone (BT), Mycological Peptone, Luria Bertani broth
duction was obtained on media containing glucose, fruc-
(LB)andLBagar(LBA)werefromDifco(USA).Allother
tose or sucrose. It is possible that, on other carbon
chemicalswereofanalyticalgrade.
sources, EPS with different composition and characteris-
ticscouldbeobtained.
Microorganismandcultureconditions
Conclusions Pantoea sp. BM39 was previously isolated from sedi-
Pantoea sp. strain BM39, probably belonging to a new ments sampled at 20 m deep in the Tyrrhenian Sea off
slightly halophilic marine species, showed rather broad the coast of Civitavecchia, Roma, Italy [3]. During the
euryhaline behavior growing up to ca. 100‰ of salinity. study the strain was maintained on PCA at 4°C and sub-
The bacterium was able to rapidly produce quite high culturedwhennecessary.
levels of a homopolymeric glucose EPS that, being Inocula were prepared suspending some loopful of the
bacteriumfrom aPCAplate in250mlErlenmeyer flasks
Table2KineticparametersofEPSproductionbyPantoea containing 50 ml of LB. Flasks were shaken cultured
sp.BM39cultivatedinshakenculturesondifferent overnightat 180rpmand28°C.
media Media for EPS production were as follows (g/L):
X(g/L) T(h) P(g/L) Y Y R(g/Lh) NaNO , 5.0; KCl, 0.5; KH PO , 1.0; FeSO x 7H O, 0.01;
P/S P/X 3 2 4 4 2
EMF 11.94±1.02a 30 11.05±1.17a 0.14 0.93 0.37±0.04a CaCO3, 35.0; Mycological Peptone, 1.0 added with glu-
EMG 13.72±1.42a 24 21.30±2.03b 0.27 1.55 0.89±0.09b cose 80.0 (EMG) or sucrose 80.0 (EMS) or fructose 80.0
(EMF).
EMS 13.06±0.94a 30 11.82±1.06a 0.15 0.91 0.39±0.04a
For EPS production, 250 ml Erlenmeyer flasks, filled
Legend:X=maximumbiomass;T=timeofmaximumEPSproduction;P=EPS
with 50 ml of each medium, wereadded with the bacter-
production;Y =yield(product/substrate);Y =yield(product/biomass);
P/S P/X
R=productivityattimeofmaximumEPSproduction.Dataarethemeansof ial inoculum produced as above (0.150 OD ) and
600
threeindependentexperiments±SD.Valuesinsamecolumnfollowedbythe
shaken cultured (180 rpm, 28°C) for 72 h. Samples were
samesuperscriptlettersarenotsignificantlydifferent(P<0.01)bythe
Tukeytest. collected every6h.Experimentsweredoneintriplicate.
Silvietal.MicrobialCellFactories2013,12:10 Page8of11
http://www.microbialcellfactories.com/content/12/1/10
Media for determination of optimal salinity for growth cooled in ice and centrifuged at 4000g for 3 min. The
were prepared adding the necessary amounts of NaCl supernatant was used for PCR reaction. Amplifications
(from 0‰ to 120‰, step 10‰) to BT 1% and YE 0.5% were performed in a reaction mixture (final volume
(LBwithoutNaCl). 25 μl) containing 2x BioMix (BioLine GmbH, Germany),
For determination of optimal salinity for growth, 15–20 ng/μl of DNA template and 5 pmol/μl of the fol-
250 ml Erlenmeyer flasks, filled with 50 ml of each lowing universal primers 1389r (ACGGGCGGTGTG
medium, were added with the bacterial inoculum pro- TACAAG) and 63f (CAGGCCTAACACATGCAAGTC)
duced as above (0.300 OD ) and shaken cultured (Sigma-Aldrich, USA). Amplification was carried out
600
™
(180 rpm, 28°C) for 36 h. Samples were collected every using a MiniCycler (MJ Research, USA) equipped with
1hduringthefirst15handevery3hthereafter.Experi- a heated lid as follows: denaturation at 95°C for 5 min;
mentswere doneintriplicate. denaturation at 95°C for 45 s; annealing at 55°C for
Allmediawereautoclaved at121°Cfor 20min. 1 min; extension at 72°C for 90 s; final extension at 72°C
for 7 min; cold-storage 4°C. Step 2, 3 and 4 were
Morphological,physiologicalandbiochemical repeatedfor30cycles.
characterization PCR products were visualized by electrophoresis on
Testswerecarriedoutonearlyexponentialphasecellsfrom agarosegel(1.0%)preparedwith0.50gofagarose(Starlab
cultures grown at 28°C. Morphological characterization was GmbH, Denmark) dissolved in 50 ml of TAE buffer 1X
done using Gram stained cells. Gram staining was car- (40 mM Tris-acetate, 1 mM EDTA, pH 8.3, Brinkmann
ried out using a commercial kit (Merck, Germany) fol- Instruments, Inc., USA) added with 5 μl of GelRed
lowing manufacturer’s instructions. Strain dimensions (10,000x,Biotium,USA).Loadingwascarriedoutbyadd-
were obtained using a Leitz Laborlux 11 microscope ing 1 μl of Loading Dye (6x, New England Biolabs, USA)
bearing a micrometric ocular calibrated with a micro- to 5 μl of each sample. The DNA Ladder GeneRuler™
metric slide (Leitz Wetzlar, Germany). Catalase and 100 bp (FERMENTAS, Lithuania) was used to quantify
oxidase tests were performed as previously described PCR products dimension by comparison. The products
[56,57]. Briefly: for oxidase activity, Kovacs reactive (1% were purified using Nucleospin Extract kit (Macherey-
of N,N,N,N tetrametil-p-phenylenediamine in water) Nagel, Germany). Sequencing reactions were performed
was added to a fresh colony. After 60 seconds, develop by Macrogen sequencing service (Macrogen Inc., Korea).
of violet color means positive reaction. For catalase, SequenceassemblywasdoneusingthesoftwareChromas
H O (3%) was added to a fresh colony: bubbles of O (version 1.5 2009, Technelysium Pty Ltd, Australia).
2 2 2
production meant a positive reaction. SequenceswithhighsimilarityavailableinNCBIGenBank
Extended metabolic competences were investigated wereidentifiedusingBLASTnsearch.
testing the strain ability to use 95 different compounds BM39 sequence was deposited to NCBI/GenBank
(including carbohydrates, carboxylic acids, polymers/oli- database with the “BankIt1581807 Pantoea KC163803”
gomers, amines/amides, aminoacids and other com- accessionnumber.
pounds) as sole carbon source by the “Biolog” system
[30,58,59] according to the manufacturer’s directions; Alignmentandtreereconstruction
results were interpreted with the most recent Biolog Automatic alignment was first carried out using CLUS-
Micrologdatabase(Biolog,Hayward,CA,USA). TALX [61],thenexported to MEGA4[62] and improved
manually. Phylogenetic tree was reconstructed by
Strainidentificationandphylogeny neighbor-joining algorithm and maximum composite
The strain was identified by analysis of the sequences of likelihood model. The robustness of the phylogenetic in-
the gene encoding for the 16S rRNA. Bacterial genomic ference was estimated using the bootstrap method [63]
DNA was extracted and used for amplification by poly- with 1000pseudo-replicates.
merase chain reaction. Products of amplification were
sequenced and compared with databases sequences. Exopolysaccharidedeterminationandpartial
Taxonomicalinformation wasalso obtainedbytheabove characterization
mentionedBiolog data base. Bacterial cells and CaCO were removed by centrifuga-
3
tion (15 min at 6000 rpm). After removing possible re-
DNAextractionandpolymerasechainreactionfor sidual CaCO from culture supernatant with 1 N HCl,
3
amplificationofthe16SrRNAgene EPS concentration was determined by precipitation at
BM39 grown for 24 h on PCA plates, was used for gen- 4°C adding 2 volumes of absolute ethanol. Precipitated
omic DNA extraction by thermal shock as follows [60]: EPS was filtered on pre-weighed Whatman GF/D discs,
a single colony suspension (in 14 μl of sterile deionized filters were then dried at 95°C for 24 h, cooled into a
water) was heated at 100°C for 5 min, immediately desiccatorandweighed.
Silvietal.MicrobialCellFactories2013,12:10 Page9of11
http://www.microbialcellfactories.com/content/12/1/10
For characterization, EPS was recovered by precipita- The physiological state of the bacterium individual
tion as above. Precipitate was collected and re-dissolved cells was characterized adding different combinations of
in distilled water: the procedure (precipitation, centrifu- the fluorogenic dyes as follows. Presence of both an in-
gation and re-dissolution in water) was repeated twice. tact polarized cytoplasmic membrane and active trans-
The final aqueous solution was dialyzed against distilled port systems, essential for a fully functional cell, was
water (24hat 4°C)freeze-dried,andweighed[8]. tested by the addition of PI and DiOC6. PI binds to
EPSwashydrolyzed with 2Nsulfuric acidat 100°Cfor DNA,but cannot crossanintactcytoplasmicmembrane,
3 h. Then, the solution was neutralized with 1 N NaOH and DiOC6 accumulates intracellularly when mem-
and filtered (Whatman discs, 0.45 μm). Sugar compo- branes are polarized or hyperpolarized [30,65,66]. In
nents were identified by thin-layer chromatography addition, cell viability has been tested using the combin-
(TLC):sugar standards were usedforidentification. ation of PI and FDA [67]. FDA is actively transported
Thin-layer chromatography (TLC) was performed on into the viable cells and is converted by membrane
silica gel plates 60 F254 (Merck, Darmstadt, Germany) esterases into a fluorogenic compound (emission at
saturated with 0.5 M KH PO using a solvent system of 530 nm): cell having good homeostasis (viability) are
2 4
lactic acid (7.4 g/L of distilled water), 2-propanol and fluorescent. As said PI enters damaged membranes and
acetone in a ratio of 5:1:10. Sugar spots were visualized indicatedyingordeadcells.
by spraying the plates with a solution made up of 96 ml
of 0.2% naphthoresorcinol solution in ethanol plus 4 ml
Statisticalanalysisofdata
ofconcentrated sulfuric acidand incubation at 100°C for One-way analysis of variance (ANOVA) and pair-wise
5min.
multiple comparisons procedure (Tukey test) were car-
EPS apparent molecular weight was determined by gel
ried out using the software SigmaStat (Jandel Scientific,
permeation chromatography as described previously CA,USA).
with slight modifications[64].Briefly, achromatographic
Superose-6 column connected to a FPLC system (Phar- Competinginterests
macia) was used for determination after calibration with Theauthorsdeclarethattheyhavenocompetinginterest.
commercial dextrans (48.6, 80.9, 147.6, 273.0, 409.8,
Authors’contribution
667.8and1400.0 kDabySigma-Aldrich).
MFandPBcarriedoutthedesignofthisstudy.MFoverviewed
fermentationsanddataanalysis.SSwasresponsibleoffermentations,
performeddeterminationsandEPScharacterization.MFandPBperformed
dataanalysis.AAperformedthephylogeneticstudyanddeterminations.BJ
Flowcytometryanalysis
performedthestudyatthecytofluorimeter.Allauthorsparticipatedin
The study has been carried outby the “Servicio de Biolo- writingandcriticalmanuscriptreview.Allauthorshavereadandapproved
gia Fundamental, Centro de Instrumentacion Cientifica”, themanuscript.
University of Granada, Granada, Spain using a FACS-
Acknowledgments
Canto II cytometer (Becton Dickinson, San José, CA, TheauthorswishtothankDr.JaimeLazuenofthe“ServiciodeBiologia
USA). The cytofluorimeter (CF) was equipped with three Fundamental,CentrodeInstrumentacionCientifica”,UniversityofGranada,
laser sets (405, 488, and 625 nm) and detectors for for- Granada,Spain,forthekindsupportinflowcytometryanalysis.
ward-scatter, side-scatter and eight fluorescence colours.
Authordetails
Acquisition from the CF and data analysis was done by 1DipartimentodiScienzeEcologicheeBiologicheandLaboratoriodi
theFACSDivav6.1.3software(BectonDickinson). MicrobiologiaMarinaApplicata,CONISMA(ConsorzioInteruniversitario
ScienzedelMare),UniversityofTuscia,Viterbo01100,Italy.2Departamento
Cells grown for 24 h at 28°C on LBA plates, containing
deMicrobiologia,FacultaddeFarmacia,CampusdeCartuja,Universityof
40‰ of NaCl, were harvested and suspended (108 cell/ml) Granada,Granada18071,Spain.3LaboratoriodiMicrobiologiaMarina
in 40‰ NaCl in distilled water. From this concentrated Applicata,CONISMA(ConsorzioInteruniversitarioScienzedelMare),
UniversityofTuscia,Viterbo01100,Italy.
suspension the necessary amount of cells were taken and
re-suspended in LB, containing different amount of NaCl Received:19December2012Accepted:27January2013
(range 0-280‰, step 40‰), to reach a final bacterial con- Published:29January2013
centration of 106 cell/ml. The various suspensions were
References
incubated in an orbital shaker (28°C and 180 rpm) for
1. SpongaF,CavalettiL,LazzariniA,BorghiA,CiciliatoI,LosiD,MarinelliF:
72h.Samples,takenafter0,1,2,4,8,12,24,48and72h, Biodiversityandpotentialsofmarine-derivedmicroorganisms.
were added with propidium iodide (PI) and 3,3-dihexylo- JBiotechnol1999,70:65–69.
2. PomponiAS:Thebioprocess-technologicalpotentialofthesea.
carbocyanine iodide (DiOC6) or fluorescein diacetate JBiotechnol1999,70:5–13.
(FDA)toreachfinalconcentrationof1.0,0.005,2.0μg/ml, 3. FeniceM,GalloAM,Juarez-JimenezB,Gonzalez-LopezJ:Screeningfor
respectively. After 15 min of incubation at 28°C stained extracellularenzymeactivitybybacteriaisolatedfromsamplescollected
intheTyrrhenianSea.AnnMicrobiol2007,57:93–100.
samples were submitted to the multi-parameter FC and
4. MunnC:MarineMicrobiology,ecologyandapplications.NewYork:Garland
analysed. Science;2004.